Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10611
Trapped Gene
Golm1 (ENSMUSG00000021556)
Vector Insertion
Chr 13: 59746584 - 59750923
Public Clones P069A10 (ggtc) M098D01 (ggtc) CMHD-GT_306G5-3 (cmhd) CMHD-GT_504G3-3 (cmhd)
CMHD-GT_474C9-3 (cmhd) CMHD-GT_535G12-5S (cmhd) IST13045F10 (tigm)
Private Clones OST453875 (lexicon) OST447998 (lexicon) OST422419 (lexicon)
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000118948 (Chr13:59750924..59751026 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000118948 (Chr13:59750924..59751026 -)
Downstram Exon
ENSMUSE00000118947 (Chr13:59746454..59746583 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000614527 Chr13:59777088..59777145 No primer for this exon
upstream ENSMUSE00000614526 Chr13:59776322..59776457 No primer for this exon
upstream ENSMUSE00000464771 Chr13:59766888..59767037 No primer for this exon
upstream ENSMUSE00000396671 Chr13:59765559..59765738 No primer for this exon
upstream ENSMUSE00000118945 Chr13:59752057..59752111 No primer for this exon
upstream ENSMUSE00000118948 Chr13:59750924..59751026 No primer for this exon

*** Putative Vector Insertion (Chr 13: 59746584 - 59750923) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000118947 Chr13:59746454..59746583 No primer for this exon
downstream ENSMUSE00000118946 Chr13:59743604..59743748 No primer for this exon
downstream ENSMUSE00000118953 Chr13:59741481..59741702 No primer for this exon
downstream ENSMUSE00000118951 Chr13:59739666..59739773 No primer for this exon
downstream ENSMUSE00000413193 Chr13:59736357..59738762 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCTACCACCTGTGGCTTT Chr13:59747878..59747898 60.17 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGTCTACCACCTGTGGCTTT Chr13:59747878..59747898 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACAGAGGCCAGTGAGGTGAC Chr13:59748042..59748062 60.31 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACAGAGGCCAGTGAGGTGAC Chr13:59748042..59748062 60.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021556