Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10625
Trapped Gene
Mthfd1l (ENSMUSG00000040675)
Vector Insertion
Chr 10: 6367908 - 6373062
Public Clones M090F07 (ggtc) G077G02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326438 (Chr10:6373063..6373397 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326438 (Chr10:6373063..6373397 -)
Downstram Exon
ENSMUSE00000326431 (Chr10:6367823..6367907 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTTGCAACAAGCTCAGCAC Chr10:6367841..6367860 60.33 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000326438 Chr10:6373063..6373397 No primer for this exon
upstream ENSMUSE00000666815 Chr10:6373063..6373428 No primer for this exon
upstream ENSMUSE00000708310 Chr10:6373063..6373423 No primer for this exon
upstream ENSMUSE00000710810 Chr10:6373063..6373410 No primer for this exon

*** Putative Vector Insertion (Chr 10: 6367908 - 6373062) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000326431 Chr10:6367823..6367907 TCTTGCAACAAGCTCAGCAC Chr10:6367841..6367860 60.33 50
downstream ENSMUSE00000326423 Chr10:6366275..6366325 TGGCCAAATTCTGGTTCATA Chr10:6366258..6366277 58.97 40
downstream ENSMUSE00000326415 Chr10:6366137..6366190 GTCTGGAGGCAAGCAGATGT Chr10:6366130..6366149 60.42 55
downstream ENSMUSE00000326406 Chr10:6362333..6362457 ATGCACTCTGGGGTCTTCAT Chr10:6362391..6362410 59.53 50
downstream ENSMUSE00000326402 Chr10:6360875..6360975 GTACGAGCTTCCCCAGATTG Chr10:6360922..6360941 59.69 55
downstream ENSMUSE00000326395 Chr10:6356544..6356680 CGACCAAGACCTTCTTTCCA Chr10:6356626..6356645 60.22 50
downstream ENSMUSE00000441421 Chr10:6338688..6338799 AGAATGGTGGTTCCTGATGG Chr10:6338692..6338711 59.78 50
downstream ENSMUSE00000441414 Chr10:6330936..6331027 GCAAGGAGACTCACGCTCTC Chr10:6330933..6330952 60.29 60
downstream ENSMUSE00000441408 Chr10:6329720..6329817 TTCGATGTTGCTGCTCTCTG Chr10:6329747..6329766 60.29 50
downstream ENSMUSE00000441403 Chr10:6327942..6328115 CAGGGACAATTGGACTTTGG Chr10:6327970..6327989 60.35 50
downstream ENSMUSE00000441397 Chr10:6318010..6318146 CTGCACTAGTCCGATGGTGA Chr10:6318067..6318086 59.85 55
downstream ENSMUSE00000441389 Chr10:6315805..6315851 ATGGGGATGACCTGAGCATA Chr10:6315790..6315809 60.3 50
downstream ENSMUSE00000441383 Chr10:6314202..6314309 ATGTCCCCAGTCAGGTGAAG Chr10:6314262..6314281 59.96 55
downstream ENSMUSE00000441377 Chr10:6313178..6313252 CTTCAGCCGAGAAAGTTGAA Chr10:6313156..6313175 58.23 45
downstream ENSMUSE00000441374 Chr10:6311223..6311325 TCACTTCCTCCTCGGTCAGT Chr10:6311252..6311271 59.83 55
downstream ENSMUSE00000441370 Chr10:6304692..6304768 AGAAATCGGTCGTTCGTGTC Chr10:6304722..6304741 60.12 50
downstream ENSMUSE00000326344 Chr10:6298570..6298710 TCCTAGCCGCTCTTTCATGT Chr10:6298602..6298621 59.98 50
downstream ENSMUSE00000326333 Chr10:6298273..6298341 CTTGATGGCGTCTTTCATCA Chr10:6298275..6298294 59.8 45
downstream ENSMUSE00000326288 Chr10:6289680..6289791 No primer for this exon
downstream ENSMUSE00000441341 Chr10:6262665..6262804 No primer for this exon
downstream ENSMUSE00000441327 Chr10:6258266..6258307 GAGAGGAACCCCAGCAGTTA Chr10:6258265..6258284 59.28 55
downstream ENSMUSE00000441325 Chr10:6257146..6257246 GCTGAGCGATCTGAATTTGC Chr10:6257164..6257183 61.03 50
downstream ENSMUSE00000441320 Chr10:6256368..6256545 TTTAGCGAGCTCACACACCA Chr10:6256478..6256497 60.6 50
downstream ENSMUSE00000441313 Chr10:6243198..6243305 CTCAATGTCCTTGGCTCCAT Chr10:6243221..6243240 60.07 50
downstream ENSMUSE00000441308 Chr10:6240012..6240164 CGTTCCCACCAAAGGATAAA Chr10:6239990..6240009 59.79 45
downstream ENSMUSE00000441470 Chr10:6198415..6198532 TGCTCCGTTTCTGTGTCAAG Chr10:6198440..6198459 60.03 50
downstream ENSMUSE00000705489 Chr10:6190438..6190891 AAACTCCAAAGACGGAAGCA Chr10:6190553..6190572 59.85 45
downstream ENSMUSE00000577400 Chr10:6190430..6190999 AACACCACTTGGCTGGAAAC Chr10:6190715..6190734 60.01 50
downstream ENSMUSE00000711680 Chr10:6179460..6180060 GTGCTTTTCGCTACGAGACC Chr10:6179874..6179893 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGTCAGGTGAGTGTCCTGT Chr10:6373048..6373068 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGACGTGACTGGGAAAAC Chr10:6372996..6373016 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040675