Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10626
Trapped Gene
Vegfa (ENSMUSG00000023951)
Vector Insertion
Chr 17: 46161044 - 46161392
Public Clones P070C07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000225014 (Chr17:46161393..46161469 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGATCAAACCTCACCAAAGC Chr17:46161443..46161462 59.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000225014 (Chr17:46161393..46161469 -)
Downstram Exon
ENSMUSE00000136596 (Chr17:46161014..46161043 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGATCAAACCTCACCAAAGC Chr17:46161443..46161462 59.53 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000500476 Chr17:46168240..46168699 CAACTTCTGGGCTCTTCTCG Chr17:46168655..46168674 60.13 55
upstream ENSMUSE00000695946 Chr17:46168240..46168305 ACTGGACCCTGGCTTTACTG Chr17:46168261..46168280 59.21 55
upstream ENSMUSE00000504072 Chr17:46165300..46165348 CACCCACGACAGAAGGAGAG Chr17:46165316..46165335 60.85 60
upstream ENSMUSE00000136598 Chr17:46162296..46162492 ATCTTCAAGCCGTCCTGTGT Chr17:46162378..46162397 59.73 50
upstream ENSMUSE00000695942 Chr17:46162254..46162492 ATCTTCAAGCCGTCCTGTGT Chr17:46162378..46162397 59.73 50
upstream ENSMUSE00000695941 Chr17:46162183..46162251 GGAGGGGCATTAGAAGGTTG Chr17:46162214..46162233 60.82 55
upstream ENSMUSE00000225014 Chr17:46161393..46161469 GGATCAAACCTCACCAAAGC Chr17:46161443..46161462 59.53 50

*** Putative Vector Insertion (Chr 17: 46161044 - 46161392) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000136596 Chr17:46161014..46161043 No primer for this exon
downstream ENSMUSE00000695945 Chr17:46159244..46159297 TTTCTTGCGCTTTCGTTTTT Chr17:46159227..46159246 60 35
downstream ENSMUSE00000224935 Chr17:46159226..46159297 TTTCTTGCGCTTTCGTTTTT Chr17:46159227..46159246 60 35
downstream ENSMUSE00000506069 Chr17:46157940..46158071 TTTCTCCGCTCTGAACAAGG Chr17:46158020..46158039 60.51 50
downstream ENSMUSE00000695944 Chr17:46155807..46155828 No primer for this exon
downstream ENSMUSE00000503039 Chr17:46155780..46155828 No primer for this exon
downstream ENSMUSE00000657287 Chr17:46153942..46155828 AAAGGACTTCGGCCTCTCTC Chr17:46155225..46155244 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGATGTGAATGCAGGTG Chr17:46161388..46161408 59.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCAGATGTGAATGCAGGTG Chr17:46161388..46161408 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023951