Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10639
Trapped Gene
Lmnb1 (ENSMUSG00000024590)
Vector Insertion
Chr 18: 56868129 - 56888054
Public Clones (sanger) (sanger) P097A10 (ggtc) D014D06 (ggtc) W175E07 (ggtc)
(ggtc) D102G07 (ggtc) Q016A08 (ggtc) P097A10 (ggtc) (ggtc)
W244B01 (ggtc) D014D06 (ggtc) W212C06 (ggtc) D106A09 (ggtc) (cmhd)
IST13631H2 (tigm)
Private Clones OST279984 (lexicon) OST193073 (lexicon) OST188156 (lexicon) OST173058 (lexicon)
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000625385 (Chr18:56867467..56868128 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCCGAGAGGAAACAAAGT Chr18:56867514..56867533 60.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000625385 (Chr18:56867467..56868128 +)
Downstram Exon
ENSMUSE00000143569 (Chr18:56888055..56888211 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCCGAGAGGAAACAAAGT Chr18:56867514..56867533 60.25 50 CGCCGCATCCTTAGAGTTTA Chr18:56888142..56888161 60.36 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000625385 Chr18:56867467..56868128 AGCCCGAGAGGAAACAAAGT Chr18:56867514..56867533 60.25 50

*** Putative Vector Insertion (Chr 18: 56868129 - 56888054) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000143569 Chr18:56888055..56888211 CGCCGCATCCTTAGAGTTTA Chr18:56888142..56888161 60.36 50
downstream ENSMUSE00000143564 Chr18:56888941..56889066 AGGCTCTGACAGCGATTCTC Chr18:56889029..56889048 59.71 55
downstream ENSMUSE00000143567 Chr18:56890624..56890794 ACTCAATCTGACGCCCAGAG Chr18:56890696..56890715 60.41 55
downstream ENSMUSE00000143562 Chr18:56892866..56892991 GAGGCTCTCGATCCTCATCC Chr18:56892964..56892983 61.26 60
downstream ENSMUSE00000143565 Chr18:56899475..56899695 GTAGGCGCTGATCTCCATGT Chr18:56899669..56899688 60.25 55
downstream ENSMUSE00000143571 Chr18:56900341..56900566 CCGACTCCTCCACATCAACT Chr18:56900456..56900475 60.11 55
downstream ENSMUSE00000494265 Chr18:56902865..56902969 No primer for this exon
downstream ENSMUSE00000491699 Chr18:56907631..56907750 CATCTTCACCAGTACCCCAAG Chr18:56907720..56907740 59.46 52.38
downstream ENSMUSE00000492660 Chr18:56909353..56909463 No primer for this exon
downstream ENSMUSE00000489632 Chr18:56912261..56913076 AGCTTGAGGAAGATCGACCA Chr18:56912338..56912357 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACTTTGGGGGTGGAAGTTCT Chr18:56874108..56874128 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTCGTGACTGGGAAAACC Chr18:56874176..56874196 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024590