Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10643
Trapped Gene
Elovl5 (ENSMUSG00000032349)
Vector Insertion
Chr 9: 77765334 - 77804947
Public Clones Q009B08 (ggtc) W215D04 (ggtc) P138G11 (ggtc) P026H07 (ggtc) D007E10 (ggtc)
P009G03 (ggtc) M119G04 (ggtc) D180A03 (ggtc) P026B12 (ggtc) D005H01 (ggtc)
(ggtc) F011D05 (ggtc) P023F05 (ggtc) D007E10 (ggtc) (cmhd)
IST15027F7 (tigm) IST14683B4 (tigm) IST11636G9 (tigm) IST14265G11 (tigm)
IST14939G9 (tigm) IST14591E9 (tigm)
Private Clones OST456066 (lexicon) OST441761 (lexicon) OST416630 (lexicon) OST408469 (lexicon)
OST388181 (lexicon) OST360058 (lexicon) OST339167 (lexicon) OST319903 (lexicon)
OST314898 (lexicon) OST296110 (lexicon) OST292768 (lexicon) OST275226 (lexicon)
OST269749 (lexicon) OST269724 (lexicon) OST251005 (lexicon) OST232866 (lexicon)
OST206868 (lexicon) OST195255 (lexicon) OST194638 (lexicon) OST192453 (lexicon)
OST190062 (lexicon) OST184757 (lexicon) OST179692 (lexicon) OST179105 (lexicon)
OST174239 (lexicon) OST173217 (lexicon) OST164822 (lexicon) OST151943 (lexicon)
OST150982 (lexicon) OST118917 (lexicon) OST98928 (lexicon) OST84897 (lexicon)
OST65296 (lexicon) OST37028 (lexicon) OST33484 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000473563 (Chr9:77765172..77765333 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000473563 (Chr9:77765172..77765333 +)
Downstram Exon
ENSMUSE00000272620 (Chr9:77804948..77805013 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGAGTGACGCATCGAAATGT Chr9:77804983..77805002 60.27 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000473563 Chr9:77765172..77765333 No primer for this exon

*** Putative Vector Insertion (Chr 9: 77765334 - 77804947) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000272620 Chr9:77804948..77805013 TGAGTGACGCATCGAAATGT Chr9:77804983..77805002 60.27 45
downstream ENSMUSE00000272601 Chr9:77808673..77808860 ATTTTGGTCCCAGCCATACA Chr9:77808771..77808790 60.19 45
downstream ENSMUSE00000272581 Chr9:77823592..77823669 TGTTCCCTGGCAGAAAAAGT Chr9:77823645..77823664 59.71 45
downstream ENSMUSE00000218959 Chr9:77824555..77824726 TGGTAGCGTGGTGGTAGACA Chr9:77824681..77824700 60.17 55
downstream ENSMUSE00000218961 Chr9:77827632..77827756 TGAGGACATGGATGAAGCTG Chr9:77827676..77827695 59.79 50
downstream ENSMUSE00000218960 Chr9:77829281..77829415 TCGTCTGGATGATTGTCAGC Chr9:77829314..77829333 59.79 50
downstream ENSMUSE00000272557 Chr9:77830472..77832323 GTCAATCCTTTCGCTGCTTC Chr9:77830619..77830638 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCAATCGTCTCTGCTTGT Chr9:77798361..77798381 59.6 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCAGTTTGTGCGTGACT Chr9:77804372..77804392 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032349