Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10651
Trapped Gene
Atg4b (ENSMUSG00000026280)
Vector Insertion
Chr 1: 95651632 - 95664629
Public Clones (sanger) D184E10 (ggtc) D184E10 (ggtc) A029E06 (ggtc) IST11559E11 (tigm)
Private Clones OST54050 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000282605 (Chr1:95651600..95651631 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000282605 (Chr1:95651600..95651631 +)
Downstram Exon
ENSMUSE00000282597 (Chr1:95664630..95664731 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTTCTGCCCAGAATCCAAAC Chr1:95664717..95664736 60.05 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000282605 Chr1:95651600..95651631 No primer for this exon

*** Putative Vector Insertion (Chr 1: 95651632 - 95664629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000282597 Chr1:95664630..95664731 TTTCTGCCCAGAATCCAAAC Chr1:95664717..95664736 60.05 45
downstream ENSMUSE00000382761 Chr1:95664830..95664901 TCTGGATGCAACATCAGACAA Chr1:95664866..95664886 60.26 42.86
downstream ENSMUSE00000356458 Chr1:95670347..95670445 ATCTGTCCACACCGAAGCAT Chr1:95670407..95670426 60.54 50
downstream ENSMUSE00000157520 Chr1:95671710..95671811 TAGCTGTCAGGCTGCCTCTT Chr1:95671752..95671771 60.3 55
downstream ENSMUSE00000157510 Chr1:95672205..95672277 TAGACTTGCCTTCGCCAACT Chr1:95672237..95672256 60.01 50
downstream ENSMUSE00000157517 Chr1:95674862..95674941 CCACAGTGTTGTCCATTGCT Chr1:95674929..95674948 59.6 50
downstream ENSMUSE00000157519 Chr1:95677295..95677488 GCAGGGAACCCATTACAGTG Chr1:95677382..95677401 60.38 55
downstream ENSMUSE00000157514 Chr1:95680989..95681067 CCAATAACACCCAGGGACTG Chr1:95681029..95681048 60.22 55
downstream ENSMUSE00000157511 Chr1:95681330..95681475 TGGGGGTCCAGATAGATGAG Chr1:95681360..95681379 59.88 55
downstream ENSMUSE00000157516 Chr1:95682487..95682543 GACTTGCTGACACCAGTCGT Chr1:95682540..95682559 58.89 55
downstream ENSMUSE00000157518 Chr1:95683088..95683181 GCTGTTCCACCAGCTCAAAC Chr1:95683139..95683158 60.84 55
downstream ENSMUSE00000382043 Chr1:95684263..95684756 GCCTTCTGATGAGCGACTTC Chr1:95684604..95684623 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAATGGTGCCCAGAGAGTC Chr1:95663630..95663650 59.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTCGTGACTGGGAAAAC Chr1:95663678..95663698 59.85 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026280