Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10693
Trapped Gene
Eif2s2 (ENSMUSG00000074656)
Vector Insertion
Chr 2: 154710183 - 154713439
Public Clones M110B03 (ggtc) M049F02 (ggtc) G074F11 (ggtc) CMHD-GT_429F9-3 (cmhd) PST19025-NR (escells)
PST18085-NR (escells) PST17758-NL (escells)
Private Clones OST425022 (lexicon) OST239379 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639771 (Chr2:154713440..154713543 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTTGACATTGATGAAGCTGAAGA Chr2:154713450..154713472 59.88 34.78 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639771 (Chr2:154713440..154713543 -)
Downstram Exon
ENSMUSE00000639770 (Chr2:154710047..154710182 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTTGACATTGATGAAGCTGAAGA Chr2:154713450..154713472 59.88 34.78 TGCCAAGCATAATGTCAAGG Chr2:154710091..154710110 59.69 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681253 Chr2:154718426..154718553 TGCGGTGCTGTGAGAAGTAT Chr2:154718523..154718542 59.47 50
upstream ENSMUSE00000639772 Chr2:154713919..154714096 AAAAAGACGTGGACGCTGAT Chr2:154713941..154713960 59.74 45
upstream ENSMUSE00000639771 Chr2:154713440..154713543 TTTGACATTGATGAAGCTGAAGA Chr2:154713450..154713472 59.88 34.78

*** Putative Vector Insertion (Chr 2: 154710183 - 154713439) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639770 Chr2:154710047..154710182 TGCCAAGCATAATGTCAAGG Chr2:154710091..154710110 59.69 45
downstream ENSMUSE00000639769 Chr2:154704206..154704300 CCAAGCAGTTTGGCTACTGA Chr2:154704217..154704236 59.07 50
downstream ENSMUSE00000639767 Chr2:154703407..154703555 GTTGAACACTCGGTTCAGCA Chr2:154703513..154703532 59.88 50
downstream ENSMUSE00000639766 Chr2:154702352..154702408 AGGAGATGTTTGGGTTGACG Chr2:154702360..154702379 59.97 50
downstream ENSMUSE00000639765 Chr2:154699285..154699370 No primer for this exon
downstream ENSMUSE00000639763 Chr2:154698173..154698636 TGTAGGATTGTGTCCGGTGA Chr2:154698566..154698585 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTGAATAATCGCCTTGCAG Chr2:154713374..154713394 60.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAACGTGACTGGGAAAACC Chr2:154710372..154710392 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCTGAATCCTGTTCCTGCT Chr2:154710505..154710525 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCTGAATCCTGTTCCTGCT Chr2:154710505..154710525 59.8 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074656