Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10697
Trapped Gene
Sgms1 (ENSMUSG00000040451)
Vector Insertion
Chr 19: 32234854 - 32297998
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
P145D10 (ggtc) D130D04 (ggtc) (ggtc) H006F03 (ggtc) E130D04 (ggtc)
(ggtc) P014F03 (ggtc) D171B10 (ggtc) (ggtc) E140A07 (ggtc) (ggtc)
H005D05 (ggtc) E045B12 (ggtc) (ggtc) E068G07 (ggtc) D149C12 (ggtc)
(ggtc) W183D07 (ggtc) E140A07 (ggtc) (ggtc) W183B06 (ggtc) D171B10 (ggtc)
(ggtc) CMHD-GT_543A10-5S (cmhd) IST14659A10 (tigm) IST14926C5 (tigm)
IST14293F2 (tigm) IST11663B3 (tigm) IST13602B3 (tigm) IST15091E7 (tigm)
IST14988C2 (tigm) IST14512G11 (tigm) IST14644C7 (tigm) IST14213B6 (tigm)
IST10491B3 (tigm) IST11627A12 (tigm) IST14741C10 (tigm) IST14926C5 (tigm)
IST14734E5 (tigm) IST14418C7 (tigm) IST14155E3 (tigm) IST14206A10 (tigm)
IST14773F5 (tigm) IST14655B6 (tigm) IST14234A1 (tigm) IST10030F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000509651 (Chr19:32297999..32298080 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAACACGCGGAGAAGCTAGT Chr19:32298044..32298063 59.64 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000509651 (Chr19:32297999..32298080 -)
Downstram Exon
ENSMUSE00000518710 (Chr19:32234014..32234853 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAACACGCGGAGAAGCTAGT Chr19:32298044..32298063 59.64 55 TCTAAGAGTCGCTGCCCATT Chr19:32234430..32234449 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691974 Chr19:32464042..32464204 AAGCCATCAGCTCCAAGAGA Chr19:32464161..32464180 60.1 50
upstream ENSMUSE00000620065 Chr19:32462710..32462943 No primer for this exon
upstream ENSMUSE00000512490 Chr19:32426435..32426513 GACAGACCTCGCCATTTGAT Chr19:32426466..32426485 60.08 50
upstream ENSMUSE00000513323 Chr19:32364031..32364121 GGAGCTGTGACCTTTTGAGC Chr19:32364082..32364101 60 55
upstream ENSMUSE00000508860 Chr19:32322484..32322526 No primer for this exon
upstream ENSMUSE00000509651 Chr19:32297999..32298080 GAACACGCGGAGAAGCTAGT Chr19:32298044..32298063 59.64 55

*** Putative Vector Insertion (Chr 19: 32234854 - 32297998) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000518710 Chr19:32234014..32234853 TCTAAGAGTCGCTGCCCATT Chr19:32234430..32234449 59.98 50
downstream ENSMUSE00000691973 Chr19:32232746..32234853 TCTAAGAGTCGCTGCCCATT Chr19:32234430..32234449 59.98 50
downstream ENSMUSE00000273252 Chr19:32217236..32217353 CAGGTACAGCGTGCCAACTA Chr19:32217283..32217302 59.93 55
downstream ENSMUSE00000273232 Chr19:32204031..32204184 AGGTGAGCGTTAGCATGACC Chr19:32204027..32204046 60.28 55
downstream ENSMUSE00000273211 Chr19:32199716..32199882 AAGATTCCAACGACGCTGAG Chr19:32199797..32199816 60.4 50
downstream ENSMUSE00000545363 Chr19:32197219..32199014 CCCCAAGCTTAACAACAGGA Chr19:32198575..32198594 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCGTATGCTTTGGAGTTCA Chr19:32255989..32256009 59.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCGTATGCTTTGGAGTTCA Chr19:32255989..32256009 59.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATCCTGGCAGTTGTTTCACA Chr19:32256081..32256101 59.14 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATCCTGGCAGTTGTTTCACA Chr19:32256081..32256101 59.14 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040451