Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI107
Trapped Gene
Sltm (ENSMUSG00000032212)
Vector Insertion
Chr 9: 70391865 - 70406843
Public Clones GC0035 (tigem) YTA076 (baygenomics) YTA080 (baygenomics) YTA084 (baygenomics)
A20008 (ggtc) W007D08 (ggtc) IST12069B12 (tigm)
Private Clones OST435491 (lexicon) OST321987 (lexicon) OST30424 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000438667 (Chr9:70391777..70391864 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACCAACCAAAGGCAAAG Chr9:70391845..70391864 59.59 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000438667 (Chr9:70391777..70391864 +)
Downstram Exon
ENSMUSE00000438663 (Chr9:70406844..70406908 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACCAACCAAAGGCAAAG Chr9:70391845..70391864 59.59 45 CTTCCACAGAAGCATCTCCAC Chr9:70406893..70406913 59.86 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000360800 Chr9:70390585..70390888 AACGGGGTCAAGACGGTACT Chr9:70390850..70390869 60.8 55
upstream ENSMUSE00000532173 Chr9:70390677..70390888 AACGGGGTCAAGACGGTACT Chr9:70390850..70390869 60.8 55
upstream ENSMUSE00000438667 Chr9:70391777..70391864 GAAACCAACCAAAGGCAAAG Chr9:70391845..70391864 59.59 45

*** Putative Vector Insertion (Chr 9: 70391865 - 70406843) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000438663 Chr9:70406844..70406908 CTTCCACAGAAGCATCTCCAC Chr9:70406893..70406913 59.86 52.38
downstream ENSMUSE00000438628 Chr9:70409583..70409780 CTGGGAATGCACAATTTCCT Chr9:70409690..70409709 59.93 45
downstream ENSMUSE00000438624 Chr9:70410621..70410668 No primer for this exon
downstream ENSMUSE00000486978 Chr9:70419956..70419983 No primer for this exon
downstream ENSMUSE00000217754 Chr9:70421264..70421732 ACCCTTCACGGAGTCTTCCT Chr9:70421619..70421638 60.11 55
downstream ENSMUSE00000438642 Chr9:70422383..70422432 No primer for this exon
downstream ENSMUSE00000438637 Chr9:70424529..70424647 CTTGGTTGAGCTTCCACTGC Chr9:70424575..70424594 60.97 55
downstream ENSMUSE00000395290 Chr9:70427089..70427238 CCAGGACTTCGAGCATTTGT Chr9:70427132..70427151 60.26 50
downstream ENSMUSE00000708047 Chr9:70427759..70427862 CGATCACTCGCGTTCTTTTT Chr9:70427856..70427875 60.39 45
downstream ENSMUSE00000708786 Chr9:70427759..70427862 CGATCACTCGCGTTCTTTTT Chr9:70427856..70427875 60.39 45
downstream ENSMUSE00000438613 Chr9:70427974..70428137 CTTGGACCATCGTCGTTCTT Chr9:70428090..70428109 60.11 50
downstream ENSMUSE00000635708 Chr9:70427974..70428137 CTTGGACCATCGTCGTTCTT Chr9:70428090..70428109 60.11 50
downstream ENSMUSE00000438606 Chr9:70428590..70428675 GACGGCCTACAATGATCTCC Chr9:70428656..70428675 59.51 55
downstream ENSMUSE00000635707 Chr9:70428590..70428675 GACGGCCTACAATGATCTCC Chr9:70428656..70428675 59.51 55
downstream ENSMUSE00000317953 Chr9:70429108..70429271 AGCCCTCTCCTTTTCTTTGC Chr9:70429143..70429162 59.96 50
downstream ENSMUSE00000635706 Chr9:70429108..70429271 AGCCCTCTCCTTTTCTTTGC Chr9:70429143..70429162 59.96 50
downstream ENSMUSE00000317935 Chr9:70431739..70431919 CTCTGTAAGCGTTCCCGTTC Chr9:70431828..70431847 59.88 55
downstream ENSMUSE00000635705 Chr9:70431739..70431919 CTCTGTAAGCGTTCCCGTTC Chr9:70431828..70431847 59.88 55
downstream ENSMUSE00000317916 Chr9:70432560..70432684 TGTTCATAGCGAAGCTGCTG Chr9:70432642..70432661 60.3 50
downstream ENSMUSE00000635704 Chr9:70432560..70432684 TGTTCATAGCGAAGCTGCTG Chr9:70432642..70432661 60.3 50
downstream ENSMUSE00000317895 Chr9:70433731..70433895 TCGCTCCAGTAAGGGTCATC Chr9:70433757..70433776 60.22 55
downstream ENSMUSE00000696296 Chr9:70433731..70433895 TCGCTCCAGTAAGGGTCATC Chr9:70433757..70433776 60.22 55
downstream ENSMUSE00000317879 Chr9:70434442..70434756 CATATTCGCTTCGCTTTTCC Chr9:70434736..70434755 59.82 45
downstream ENSMUSE00000696295 Chr9:70434442..70434756 CATATTCGCTTCGCTTTTCC Chr9:70434736..70434755 59.82 45
downstream ENSMUSE00000317866 Chr9:70434858..70435002 TGAGGCACTACTCCGATTCC Chr9:70434945..70434964 60.22 55
downstream ENSMUSE00000696292 Chr9:70434858..70435002 TGAGGCACTACTCCGATTCC Chr9:70434945..70434964 60.22 55
downstream ENSMUSE00000397078 Chr9:70436764..70436924 CATCACCCATTCGTCTTGTG Chr9:70436890..70436909 59.96 50
downstream ENSMUSE00000696288 Chr9:70436764..70436924 CATCACCCATTCGTCTTGTG Chr9:70436890..70436909 59.96 50
downstream ENSMUSE00000532159 Chr9:70439386..70440039 TACTCCGAAATGCAGGGAAC Chr9:70439936..70439955 60.07 50
downstream ENSMUSE00000696287 Chr9:70439386..70439879 GGAAGCTTGCGTTAAAATCG Chr9:70439508..70439527 59.85 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTAATCGCCTTGCAGCAC Chr9:70397913..70397933 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACTTGCGTGACTGGGAAAAC Chr9:70397910..70397931 60.16 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032212