Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10719
Trapped Gene
Zfp60 (ENSMUSG00000037640)
Vector Insertion
Chr 7: 28516684 - 28521954
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) 3SD136D09 (ggtc)
P108F08 (ggtc) 5SE285D04 (ggtc) (ggtc) D103D11 (ggtc) 3SH002F06 (ggtc)
(ggtc) H002F06 (ggtc) 3SD088B04 (ggtc) E033E08 (ggtc) 3SE285D04 (ggtc)
(ggtc) 5SD136D09 (ggtc) P033F06 (ggtc) 3SE286B08 (ggtc) (ggtc)
E001E08 (ggtc) 3SE028B03 (ggtc) (ggtc) IST14666G9 (tigm) IST14591A7 (tigm)
IST10024C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676350 (Chr7:28516428..28516683 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTTAGGGACGGTGCTGTGT Chr7:28516556..28516575 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676350 (Chr7:28516428..28516683 +)
Downstram Exon
ENSMUSE00000713205 (Chr7:28521955..28522007 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTTAGGGACGGTGCTGTGT Chr7:28516556..28516575 60.03 55 GTTGGCCATTCTTCTTCAGG Chr7:28521986..28522005 59.67 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676347 Chr7:28516408..28516489 TCGGGTCTTTCTGGTCTGAG Chr7:28516436..28516455 60.38 55
upstream ENSMUSE00000676350 Chr7:28516428..28516683 GTTTAGGGACGGTGCTGTGT Chr7:28516556..28516575 60.03 55

*** Putative Vector Insertion (Chr 7: 28516684 - 28521954) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000597846 Chr7:28521955..28522007 GTTGGCCATTCTTCTTCAGG Chr7:28521986..28522005 59.67 50
downstream ENSMUSE00000713205 Chr7:28521955..28522007 GTTGGCCATTCTTCTTCAGG Chr7:28521986..28522005 59.67 50
downstream ENSMUSE00000597848 Chr7:28523322..28523448 CGACCAGGTTGCTGTAGGTC Chr7:28523445..28523464 60.71 60
downstream ENSMUSE00000597847 Chr7:28525976..28526074 TCTTTCTTCACAGCCATCCA Chr7:28526057..28526076 59.37 45
downstream ENSMUSE00000563275 Chr7:28533187..28536708 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50
downstream ENSMUSE00000676346 Chr7:28533187..28538721 AGGCTGGAGACACGCTTAAA Chr7:28534501..28534520 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAATGTGGGCAGGTAATCG Chr7:28516721..28516741 59.82 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAGCAATGGTCTTTGGGATCA Chr7:28516644..28516665 60.45 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037640