Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10754
Trapped Gene
Jub (ENSMUSG00000022178)
Vector Insertion
Chr 14: 55190671 - 55192228
Public Clones P145A06 (ggtc) P145A06 (ggtc) P147E06 (ggtc) P145A06 (ggtc) (ggtc)
PST12-1 (escells) PST424-1 (escells) PST1606-1 (escells) PSTVU01.E19G (vanderbilt)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323033 (Chr14:55192229..55192330 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTGCTTTGTCTGCTGCTC Chr14:55192234..55192253 59.93 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323033 (Chr14:55192229..55192330 -)
Downstram Exon
ENSMUSE00000124173 (Chr14:55190603..55190670 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTGCTTTGTCTGCTGCTC Chr14:55192234..55192253 59.93 55 CAGAGCCATTGACGCTGTAG Chr14:55190604..55190623 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000387666 Chr14:55195069..55196251 GGAACGGTTAGGGGAGAAAG Chr14:55196080..55196099 59.93 55
upstream ENSMUSE00000323033 Chr14:55192229..55192330 CAGTGCTTTGTCTGCTGCTC Chr14:55192234..55192253 59.93 55

*** Putative Vector Insertion (Chr 14: 55190671 - 55192228) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000124173 Chr14:55190603..55190670 CAGAGCCATTGACGCTGTAG Chr14:55190604..55190623 59.62 55
downstream ENSMUSE00000323017 Chr14:55190438..55190500 TCTCAGCTGCCTCCTGAAAC Chr14:55190451..55190470 60.68 55
downstream ENSMUSE00000124170 Chr14:55189214..55189344 ACACCTGGTTGGAGAAGTCC Chr14:55189214..55189233 59 55
downstream ENSMUSE00000124172 Chr14:55189082..55189133 No primer for this exon
downstream ENSMUSE00000124174 Chr14:55188313..55188381 CCATGGATATCACCCTCACA Chr14:55188326..55188345 59.17 50
downstream ENSMUSE00000491884 Chr14:55186312..55187893 AAGCGGCTAGAACCAAGTCA Chr14:55186804..55186823 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTGCTTTGTCTGCTGCTC Chr14:55192232..55192252 59.93 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTGCTTTGTCTGCTGCTC Chr14:55192232..55192252 59.93 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCCCCGACTCTTCTTATCTCA Chr14:55192330..55192351 60.58 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022178