Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10771
Trapped Gene
Csrp2 (ENSMUSG00000020186)
Vector Insertion
Chr 10: 110357311 - 110369010
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) W259B04 (ggtc) H005B04 (ggtc)
D065H05 (ggtc) (ggtc) D041G02 (ggtc) E089E08 (ggtc) (ggtc)
P011E12 (ggtc) P138B05 (ggtc) E035B07 (ggtc) (ggtc) W192A04 (ggtc)
E130F03 (ggtc) D041G02 (ggtc) (ggtc) P027F12 (ggtc) P139E09 (ggtc)
E085E08 (ggtc) (ggtc) P011D06 (ggtc) P136B06 (ggtc) D065H05 (ggtc)
(ggtc) D048D06 (ggtc) M070C04 (ggtc) E089E08 (ggtc) D017H10 (ggtc)
(ggtc) P062H05 (ggtc) P139E09 (ggtc) E035B07 (ggtc) (ggtc)
CMHD-GT_301G3-3 (cmhd) CMHD-GT_535E6-3 (cmhd) IST14750H8 (tigm) IST10762G8 (tigm)
IST10928F2 (tigm) IST14646B1 (tigm) IST15085C11 (tigm) IST12275C3 (tigm)
Private Clones OST456135 (lexicon) OST454776 (lexicon) OST453834 (lexicon) OST439582 (lexicon)
OST438525 (lexicon) OST435762 (lexicon) OST430786 (lexicon) OST427638 (lexicon)
OST415407 (lexicon) OST381758 (lexicon) OST377251 (lexicon) OST362156 (lexicon)
OST360139 (lexicon) OST349452 (lexicon) OST347658 (lexicon) OST346325 (lexicon)
OST346138 (lexicon) OST324166 (lexicon) OST296100 (lexicon) OST295441 (lexicon)
OST272887 (lexicon) OST267007 (lexicon) OST261946 (lexicon) OST260002 (lexicon)
OST258352 (lexicon) OST252188 (lexicon) OST251858 (lexicon) OST249944 (lexicon)
OST243947 (lexicon) OST232084 (lexicon) OST231733 (lexicon) OST209210 (lexicon)
OST206038 (lexicon) OST203688 (lexicon) OST188068 (lexicon) OST184387 (lexicon)
OST155138 (lexicon) OST149650 (lexicon) OST139336 (lexicon) OST138010 (lexicon)
OST136785 (lexicon) OST134727 (lexicon) OST133586 (lexicon) OST125652 (lexicon)
OST123426 (lexicon) OST122387 (lexicon) OST122386 (lexicon) OST122372 (lexicon)
OST122332 (lexicon) OST122322 (lexicon) OST122304 (lexicon) OST122301 (lexicon)
OST122276 (lexicon) OST122267 (lexicon) OST122249 (lexicon) OST122229 (lexicon)
OST111981 (lexicon) OST102661 (lexicon) OST99067 (lexicon) OST93081 (lexicon)
OST68701 (lexicon) OST68581 (lexicon) OST67809 (lexicon) OST66895 (lexicon)
OST63832 (lexicon) OST57133 (lexicon) OST54448 (lexicon) OST39050 (lexicon)
OST37997 (lexicon) OST37996 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369473 (Chr10:110357235..110357310 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369473 (Chr10:110357235..110357310 +)
Downstram Exon
ENSMUSE00000101586 (Chr10:110369011..110369123 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369473 Chr10:110357235..110357310 No primer for this exon

*** Putative Vector Insertion (Chr 10: 110357311 - 110369010) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000101586 Chr10:110369011..110369123 No primer for this exon
downstream ENSMUSE00000101593 Chr10:110372204..110372372 No primer for this exon
downstream ENSMUSE00000101596 Chr10:110374793..110374922 No primer for this exon
downstream ENSMUSE00000573921 Chr10:110375693..110375786 No primer for this exon
downstream ENSMUSE00000438184 Chr10:110376267..110376678 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTGCTGTCCAAGCACCTA Chr10:110366344..110366364 59.04 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCTGAGTGTCTGCTGTCC Chr10:110363334..110363355 60.6 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020186