Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10775
Trapped Gene
Rg9mtd1 (ENSMUSG00000044763)
Vector Insertion
Chr 16: 56035405 - 56037613
Public Clones (sanger) (sanger) D045D04 (ggtc) D145A05 (ggtc) D045D04 (ggtc)
E062A11 (ggtc) (ggtc) D045E04 (ggtc) D045E04 (ggtc) D145A05 (ggtc)
CMHD-GT_258D1-3 (cmhd) CMHD-GT_441B12-3 (cmhd) CMHD-GT_247E01-3 (cmhd) CMHD-GT_265C9-3 (cmhd)
CMHD-GT_258C10-3 (cmhd) CMHD-GT_265A6-3 (cmhd) (egtc) IST14748H11 (tigm)
Private Clones OST295412 (lexicon) OST288667 (lexicon) OST223306 (lexicon) OST193413 (lexicon)
OST187411 (lexicon) OST77722 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000369701 (Chr16:56037614..56037893 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCCGTGCTGTAGGAGTC Chr16:56037684..56037703 60.02 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000369701 (Chr16:56037614..56037893 -)
Downstram Exon
ENSMUSE00000393135 (Chr16:56033840..56035404 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCCGTGCTGTAGGAGTC Chr16:56037684..56037703 60.02 60 TTGTAGCTTTCCACCCATCC Chr16:56035166..56035185 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000369701 Chr16:56037614..56037893 GAAGCCGTGCTGTAGGAGTC Chr16:56037684..56037703 60.02 60

*** Putative Vector Insertion (Chr 16: 56035405 - 56037613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000393135 Chr16:56033840..56035404 TTGTAGCTTTCCACCCATCC Chr16:56035166..56035185 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAAGTCGTCGGGGTCTGTC Chr16:56037592..56037612 59.58 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAAGTCGTCGGGGTCTGTC Chr16:56037592..56037612 59.58 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTAGAGACCACCGCAGAAG Chr16:56037883..56037903 60.16 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTAGAGACCACCGCAGAAG Chr16:56037883..56037903 60.16 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044763