Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10778
Trapped Gene
AC154532.3-202 (ENSMUSG00000056234)
Vector Insertion
Chr 14: 32973197 - 32983933
Public Clones (sanger) (sanger) (sanger) (sanger) 3SE064H08 (ggtc) P106D01 (ggtc)
3SP141F10 (ggtc) 3SE028G09 (ggtc) (ggtc) P110B03 (ggtc) 5SE078E04 (ggtc)
5SP106D01 (ggtc) 5SE032G10 (ggtc) P141F10 (ggtc) 3SE112D05 (ggtc)
5SP125H05 (ggtc) (ggtc) Q008E04 (ggtc) 5SE077E05 (ggtc) 5SP141F10 (ggtc)
5SE032G09 (ggtc) (ggtc) P082B06 (ggtc) 3SE087D12 (ggtc) 3SP125H05 (ggtc)
CMHD-GT_320G2-3 (cmhd) CMHD-GT_524B4-3 (cmhd) CMHD-GT_262G2-3 (cmhd) (cmhd)
CMHD-GT_524B4-5S (cmhd) IST10073D10 (tigm) IST12965D5 (tigm) IST11742G8 (tigm)
IST10053H9 (tigm) IST14157E9 (tigm) IST10758F9 (tigm) IST12965D5 (tigm)
IST14172E8 (tigm)
Private Clones OST462051 (lexicon) OST413593 (lexicon) OST325401 (lexicon) OST319054 (lexicon)
OST305507 (lexicon) OST292838 (lexicon) OST286765 (lexicon) OST278286 (lexicon)
OST248284 (lexicon) OST237118 (lexicon) OST232362 (lexicon) OST222104 (lexicon)
OST210133 (lexicon) OST205234 (lexicon) OST204605 (lexicon) OST199058 (lexicon)
OST151041 (lexicon) OST149639 (lexicon) OST148374 (lexicon) OST67778 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690094 (Chr14:32973169..32973196 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690094 (Chr14:32973169..32973196 +)
Downstram Exon
ENSMUSE00000343400 (Chr14:32983934..32984088 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TTCAGCCCGAAGTACTCCAC Chr14:32984064..32984083 60.26 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690094 Chr14:32973169..32973196 No primer for this exon

*** Putative Vector Insertion (Chr 14: 32973197 - 32983933) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000343400 Chr14:32983934..32984088 TTCAGCCCGAAGTACTCCAC Chr14:32984064..32984083 60.26 55
downstream ENSMUSE00000121903 Chr14:32985489..32985629 CATTCCAGGTGGCGACTTAT Chr14:32985535..32985554 59.96 50
downstream ENSMUSE00000121900 Chr14:32985793..32985881 No primer for this exon
downstream ENSMUSE00000121906 Chr14:32986075..32986183 AAGGGATCCAAATGTGGTGA Chr14:32986177..32986196 60.17 45
downstream ENSMUSE00000121904 Chr14:32986587..32986676 CCATCAGATGCTCAGGGATT Chr14:32986611..32986630 60.03 50
downstream ENSMUSE00000486461 Chr14:32987576..32987719 CTGAAGACCAATGGCAGGTT Chr14:32987653..32987672 60.11 50
downstream ENSMUSE00000121901 Chr14:32989125..32990141 GGCCTCCAAGTGGTCATTTA Chr14:32989568..32989587 59.93 50
downstream ENSMUSE00000484533 Chr14:32990419..32990559 GCTGCATACAGGCAAAGAGA Chr14:32990518..32990537 59.18 50
downstream ENSMUSE00000690091 Chr14:32991009..32992438 GTGTACCGGGATGTGGTTTC Chr14:32991287..32991306 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:32973247..32973267 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCTAGGCCAACGTGACTGG Chr14:32973237..32973257 60.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056234