Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10791
Trapped Gene
Wtap (ENSMUSG00000060475)
Vector Insertion
Chr 17: 13173816 - 13174615
Public Clones 3SP148C09 (ggtc) P148C09 (ggtc) 5SP148C09 (ggtc) (egtc)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000135725 (Chr17:13174616..13174674 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCAAGCTTTGGAGGGAAA Chr17:13174633..13174652 59.29 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000135725 (Chr17:13174616..13174674 -)
Downstram Exon
ENSMUSE00000135728 (Chr17:13173688..13173815 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCAAGCTTTGGAGGGAAA Chr17:13174633..13174652 59.29 45 TCTCCTGCTCTTTGGTTGCT Chr17:13173680..13173699 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703761 Chr17:13184943..13185021 No primer for this exon
upstream ENSMUSE00000555871 Chr17:13178782..13178819 TGCAAGATGACCAACGAAGA Chr17:13178798..13178817 60.39 45
upstream ENSMUSE00000243365 Chr17:13176323..13176378 AAGTTATGGCACGGGATGAG Chr17:13176334..13176353 59.96 50
upstream ENSMUSE00000135725 Chr17:13174616..13174674 GTTCAAGCTTTGGAGGGAAA Chr17:13174633..13174652 59.29 45

*** Putative Vector Insertion (Chr 17: 13173816 - 13174615) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000135728 Chr17:13173688..13173815 TCTCCTGCTCTTTGGTTGCT Chr17:13173680..13173699 60.13 50
downstream ENSMUSE00000464217 Chr17:13168162..13168340 CATTTTGGGCTTGTTCCAGT Chr17:13168171..13168190 59.97 45
downstream ENSMUSE00000135730 Chr17:13162271..13162425 CATTCGACACTTCGCCATTA Chr17:13162367..13162386 59.69 45
downstream ENSMUSE00000483745 Chr17:13159669..13160917 ACTTGGTCCATTTGCCAGAC Chr17:13160669..13160688 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAAGCTTTGGAGGGAAAGT Chr17:13174629..13174650 60.23 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAAGCTTTGGAGGGAAAGT Chr17:13174629..13174650 60.23 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTTCAAGCTTTGGAGGGAAA Chr17:13174631..13174651 59.29 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GTTCAAGCTTTGGAGGGAAA Chr17:13174631..13174651 59.29 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060475