Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10795
Trapped Gene
Jam2 (ENSMUSG00000053062)
Vector Insertion
Chr 16: 84801884 - 84807079
Public Clones (sanger) (sanger) P122E11 (ggtc) G057B03 (ggtc) P027B04 (ggtc)
CMHD-GT_524G7-3 (cmhd) IST12645C3 (tigm)
Private Clones OST409725 (lexicon) OST382333 (lexicon) OST333211 (lexicon) OST318899 (lexicon)
OST306561 (lexicon) OST280915 (lexicon) OST254712 (lexicon) OST242455 (lexicon)
OST239173 (lexicon) OST233132 (lexicon) OST198969 (lexicon) OST198840 (lexicon)
OST130413 (lexicon) OST99240 (lexicon) OST68282 (lexicon) OST58238 (lexicon)
OST52558 (lexicon) OST35449 (lexicon) OST32105 (lexicon)
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268247 (Chr16:84801815..84801883 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCAAAAGACCACCGTCAA Chr16:84801839..84801858 59.54 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268247 (Chr16:84801815..84801883 +)
Downstram Exon
ENSMUSE00000268240 (Chr16:84807080..84807187 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCAAAAGACCACCGTCAA Chr16:84801839..84801858 59.54 45 TGGGGTTTTACAAGCCAAAA Chr16:84807108..84807127 60.33 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698472 Chr16:84774368..84774798 GTCCTAGGGCCAGAAGACCT Chr16:84774523..84774542 59.7 60
upstream ENSMUSE00000465097 Chr16:84774528..84774798 GACTGACATCGGGACAGGAC Chr16:84774582..84774601 60.54 60
upstream ENSMUSE00000698466 Chr16:84774631..84774798 GATGCTGCTGCTGCTACACT Chr16:84774758..84774777 59.37 55
upstream ENSMUSE00000268247 Chr16:84801815..84801883 CATCAAAAGACCACCGTCAA Chr16:84801839..84801858 59.54 45

*** Putative Vector Insertion (Chr 16: 84801884 - 84807079) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268240 Chr16:84807080..84807187 TGGGGTTTTACAAGCCAAAA Chr16:84807108..84807127 60.33 40
downstream ENSMUSE00000496500 Chr16:84809589..84809741 CACAGCGATACTCTCCAGCA Chr16:84809678..84809697 60.16 55
downstream ENSMUSE00000634408 Chr16:84809589..84811241 TTCCAGACCCTAGCATGGAC Chr16:84809998..84810017 60.07 55
downstream ENSMUSE00000131665 Chr16:84813144..84813343 CCTTCTTTATCCTGGCATCG Chr16:84813231..84813250 59.66 50
downstream ENSMUSE00000131671 Chr16:84815414..84815513 CTCCACTGTCCATCTTGGAA Chr16:84815450..84815469 58.64 50
downstream ENSMUSE00000131673 Chr16:84816511..84816618 ACCACCACAACCGTTGCTAT Chr16:84816556..84816575 60.3 50
downstream ENSMUSE00000698469 Chr16:84819005..84819020 No primer for this exon
downstream ENSMUSE00000131670 Chr16:84821505..84821547 No primer for this exon
downstream ENSMUSE00000404528 Chr16:84823032..84823128 TTTGGTGCAGCTCAAAACTG Chr16:84823095..84823114 60.03 45
downstream ENSMUSE00000698468 Chr16:84823032..84826173 TTTGGTGCAGCTCAAAACTG Chr16:84823095..84823114 60.03 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCATGTAATCGCCTTGCAG Chr16:84801929..84801949 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCATACCTCATGCGTGACT Chr16:84801922..84801942 60.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053062