Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10803
Trapped Gene
Pvrl2 (ENSMUSG00000062300)
Vector Insertion
Chr 7: 20323724 - 20334563
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) P104H12 (ggtc) E055G08 (ggtc)
D010E07 (ggtc) E324G12 (ggtc) E033A08 (ggtc) (ggtc) P030D01 (ggtc)
E115D11 (ggtc) P104H12 (ggtc) E047G05 (ggtc) D037F07 (ggtc) E324G12 (ggtc)
D127F12 (ggtc) (ggtc) W168F02 (ggtc) E115D11 (ggtc) E326D01 (ggtc)
E047G05 (ggtc) (ggtc) M125F01 (ggtc) E324A06 (ggtc) CMHD-GT_545H11-3 (cmhd)
CMHD-GT_545H11-5S (cmhd) PST22203-NR (escells) IST12517A6 (tigm) IST14651D4 (tigm)
IST14521A3 (tigm) IST11504H12 (tigm) IST14631C10 (tigm) IST14317D3 (tigm)
IST12517A6 (tigm) IST13543A11 (tigm) IST10619E10 (tigm) IST10984B5 (tigm)
Private Clones OST464511 (lexicon) OST446125 (lexicon) OST440677 (lexicon) OST428417 (lexicon)
OST412673 (lexicon) OST368453 (lexicon) OST324914 (lexicon) OST268341 (lexicon)
OST249693 (lexicon) OST240460 (lexicon) OST232398 (lexicon) OST226294 (lexicon)
OST222023 (lexicon) OST209433 (lexicon) OST207350 (lexicon) OST198483 (lexicon)
OST192623 (lexicon) OST187404 (lexicon) OST185619 (lexicon) OST169899 (lexicon)
OST169309 (lexicon) OST154756 (lexicon) OST65642 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000536242 (Chr7:20334564..20334818 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGATCGGTACACGAAGAGT Chr7:20334700..20334719 60.13 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000536242 (Chr7:20334564..20334818 -)
Downstram Exon
ENSMUSE00000357931 (Chr7:20323361..20323723 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGATCGGTACACGAAGAGT Chr7:20334700..20334719 60.13 55 GGCAAACTCGCAGGTGTAAT Chr7:20323388..20323407 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536242 Chr7:20334564..20334818 CCGATCGGTACACGAAGAGT Chr7:20334700..20334719 60.13 55

*** Putative Vector Insertion (Chr 7: 20323724 - 20334563) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000357931 Chr7:20323361..20323723 GGCAAACTCGCAGGTGTAAT Chr7:20323388..20323407 60.14 50
downstream ENSMUSE00000198358 Chr7:20318264..20318560 GCTCTTCGAAGCTCTCGTGT Chr7:20318275..20318294 59.9 55
downstream ENSMUSE00000198353 Chr7:20315961..20316078 CTGGGTTGCTTCGTACATCA Chr7:20315964..20315983 59.72 50
downstream ENSMUSE00000198361 Chr7:20315387..20315535 TTGACCATTCGATCCACAGA Chr7:20315436..20315455 60.05 45
downstream ENSMUSE00000676814 Chr7:20309830..20310218 GATCCTCTGTCGCCATCATT Chr7:20310031..20310050 60.04 50
downstream ENSMUSE00000198359 Chr7:20306702..20306855 GGCAGCGATAATACCTCCAA Chr7:20306772..20306791 60.06 50
downstream ENSMUSE00000198354 Chr7:20304782..20304845 No primer for this exon
downstream ENSMUSE00000198357 Chr7:20304545..20304631 CCCCAAGGTGAAGAGTTGAG Chr7:20304586..20304605 59.69 55
downstream ENSMUSE00000485480 Chr7:20302015..20303136 CAGATGCCCAGATTCTCCAT Chr7:20302047..20302066 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTAATCGCCTTGCAGCACA Chr7:20334494..20334514 61.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGAGCGTGACTGGGAAAA Chr7:20334498..20334518 60.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr7:20334749..20334769 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATGTCAGGAGCCTTGGAGAG Chr7:20331817..20331837 59.4 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000062300