Warning: Division by zero in /data/apache/unitrap.crg.es/htdocs/pcr.php on line 116
CBM UniTrap Project

Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10804
Trapped Gene
AC165425.2 (ENSMUSG00000058922)
Vector Insertion
Chr 9: 123598405 - 123598560
Public Clones P056B01 (ggtc) D021H04 (ggtc) P134H11 (ggtc) A064F04 (ggtc) P106A03 (ggtc)
P141F03 (ggtc) D010H08 (ggtc) P129F01 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633382 (Chr9:123598561..123599310 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCGACGAGAGTCTGAGGA Chr9:123599217..123599236 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633382 (Chr9:123598561..123599310 -)
Downstram Exon
ENSMUSE00000462281 (Chr9:123598348..123598404 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCGACGAGAGTCTGAGGA Chr9:123599217..123599236 59.99 55 TGCCATAGCTACTGCTGCTG Chr9:123598343..123598362 60.32 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633382 Chr9:123598561..123599310 AACCGACGAGAGTCTGAGGA Chr9:123599217..123599236 59.99 55

*** Putative Vector Insertion (Chr 9: 123598405 - 123598560) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000462281 Chr9:123598348..123598404 TGCCATAGCTACTGCTGCTG Chr9:123598343..123598362 60.32 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATTTGGCAATGATGGAAG Chr9:123598554..123598574 60.27 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATTTGGCAATGATGGAAG Chr9:123598554..123598574 60.27 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058922