Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10807
Trapped Gene
Tjap1 (ENSMUSG00000012296)
Vector Insertion
Chr 17: 46419389 - 46419908
Public Clones D015E06 (ggtc) M124F02 (ggtc) IST14583B1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000398694 (Chr17:46419909..46419948 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000398694 (Chr17:46419909..46419948 -)
Downstram Exon
ENSMUSE00000222842 (Chr17:46419295..46419388 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000398694 Chr17:46419909..46419948 No primer for this exon

*** Putative Vector Insertion (Chr 17: 46419389 - 46419908) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222842 Chr17:46419295..46419388 No primer for this exon
downstream ENSMUSE00000136622 Chr17:46401832..46401927 No primer for this exon
downstream ENSMUSE00000136626 Chr17:46400638..46400762 No primer for this exon
downstream ENSMUSE00000136629 Chr17:46399351..46399379 No primer for this exon
downstream ENSMUSE00000136624 Chr17:46398368..46398529 No primer for this exon
downstream ENSMUSE00000136628 Chr17:46398085..46398151 No primer for this exon
downstream ENSMUSE00000136625 Chr17:46397044..46397151 No primer for this exon
downstream ENSMUSE00000136627 Chr17:46396886..46396969 No primer for this exon
downstream ENSMUSE00000136623 Chr17:46394826..46396432 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr17:46419838..46419858 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGTTGAGGGCGTGACTG Chr17:46419849..46419869 61.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTTGTTGTTAATCGCCTTGC Chr17:46419886..46419906 58.82 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTGTTGTCGTGACTGGGAAA Chr17:46419885..46419905 60.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000012296