Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10816
Trapped Gene
Nap1l4 (ENSMUSG00000059119)
Vector Insertion
Chr 7: 150734946 - 150734996
Public Clones P116G08 (ggtc) D028H05 (ggtc) (ggtc) P023E06 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000667974 (Chr7:150734947..150734995 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000667974 (Chr7:150734947..150734995 -)
Downstram Exon
ENSMUSE00000705416 (Chr7:150734947..150734997 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000667974 Chr7:150734947..150734995 No primer for this exon
upstream ENSMUSE00000705416 Chr7:150734947..150734997 No primer for this exon

*** Putative Vector Insertion (Chr 7: 150734946 - 150734996) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000667973 Chr7:150727653..150727683 TGTTTTCTGCCATCTGAACG Chr7:150727632..150727651 59.84 45
downstream ENSMUSE00000223797 Chr7:150726093..150726151 TGGCATTTTTAGCAGCTTCC Chr7:150726080..150726099 60.34 45
downstream ENSMUSE00000206292 Chr7:150724122..150724221 TGTCAAGACGTTCCTGCAAA Chr7:150724134..150724153 60.43 45
downstream ENSMUSE00000206283 Chr7:150721803..150721944 GGCTGGTACAAGGCTGCATA Chr7:150721794..150721813 61.19 55
downstream ENSMUSE00000206286 Chr7:150721556..150721642 CACGCTGACTCTGCATCTGT Chr7:150721568..150721587 60.21 55
downstream ENSMUSE00000206294 Chr7:150720191..150720322 CTGCACCAGCTCACTAAGCA Chr7:150720169..150720188 60.35 55
downstream ENSMUSE00000481971 Chr7:150718214..150718285 CATAGGTTGTCCAGGGTCTGA Chr7:150718192..150718212 59.97 52.38
downstream ENSMUSE00000206284 Chr7:150715323..150715462 TTCGTCAGGACAGGATTGGT Chr7:150715379..150715398 60.51 50
downstream ENSMUSE00000206285 Chr7:150713071..150713216 TTGCTTGGTGATGGTTCGTA Chr7:150713092..150713111 60.11 45
downstream ENSMUSE00000474841 Chr7:150710599..150710621 No primer for this exon
downstream ENSMUSE00000206287 Chr7:150710066..150710185 GGCTAAGGTGAACTCGGAATC Chr7:150710137..150710157 60.09 52.38
downstream ENSMUSE00000460381 Chr7:150707306..150707335 CTTCACCTTCCTCGCCTTCT Chr7:150707289..150707308 60.89 55
downstream ENSMUSE00000427740 Chr7:150706289..150706345 TGGGGTTAACATCAGCATCA Chr7:150706269..150706288 59.92 45
downstream ENSMUSE00000667965 Chr7:150704755..150704790 No primer for this exon
downstream ENSMUSE00000631620 Chr7:150700534..150700542 No primer for this exon
downstream ENSMUSE00000667966 Chr7:150700397..150700531 TTCTCACTGCTGCTTGCACT Chr7:150700479..150700498 59.93 50
downstream ENSMUSE00000498169 Chr7:150699484..150700542 TTCTCACTGCTGCTTGCACT Chr7:150700479..150700498 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATGGCAGGTGGTTTTGTTG Chr7:150735010..150735031 63.5 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059119