Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10821
Trapped Gene
AI480653 (ENSMUSG00000047434)
Vector Insertion
Chr 16: 30957821 - 31007799
Public Clones G059F02 (ggtc) P069D11 (ggtc) D024G12 (ggtc) G059A05 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000335839 (Chr16:31007800..31007932 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACATCCGAGAGCTGTTT Chr16:31007868..31007887 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000335839 (Chr16:31007800..31007932 -)
Downstram Exon
ENSMUSE00000413174 (Chr16:30955722..30957820 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACATCCGAGAGCTGTTT Chr16:31007868..31007887 60.26 50 GATGGCTGTAGAGCGGAGAC Chr16:30957659..30957678 59.98 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000336588 Chr16:31080921..31081466 GGTGTGCGCCTTCTACTACC Chr16:31081301..31081320 59.76 60
upstream ENSMUSE00000373867 Chr16:31050718..31050865 CTTCCATGATGTTGCTGTGC Chr16:31050841..31050860 60.27 50
upstream ENSMUSE00000335839 Chr16:31007800..31007932 CCAACATCCGAGAGCTGTTT Chr16:31007868..31007887 60.26 50

*** Putative Vector Insertion (Chr 16: 30957821 - 31007799) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000413174 Chr16:30955722..30957820 GATGGCTGTAGAGCGGAGAC Chr16:30957659..30957678 59.98 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTATCCTTCCAGGGGAGAGC Chr16:30986783..30986803 60.17 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTATCCTTCCAGGGGAGAGC Chr16:30986783..30986803 60.17 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047434