Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10834
Trapped Gene
Tgif1 (ENSMUSG00000047407)
Vector Insertion
Chr 17: 71201075 - 71202787
Public Clones (sanger) (sanger) P067A01 (ggtc) F032F01 (ggtc) D037G01 (ggtc)
(cmhd) PST22816-NR (escells) IST14148C12 (tigm) IST10407G1 (tigm)
IST12317A10 (tigm) IST14140C12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710962 (Chr17:71202788..71202886 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCTCCGACTTCTTAACTGC Chr17:71202852..71202871 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710962 (Chr17:71202788..71202886 -)
Downstram Exon
ENSMUSE00000718089 (Chr17:71200650..71201074 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCTCCGACTTCTTAACTGC Chr17:71202852..71202871 60.15 55 GAAAAGACACCCCCATCCTT Chr17:71200872..71200891 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710962 Chr17:71202788..71202886 CGCTCCGACTTCTTAACTGC Chr17:71202852..71202871 60.15 55

*** Putative Vector Insertion (Chr 17: 71201075 - 71202787) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000718089 Chr17:71200650..71201074 GAAAAGACACCCCCATCCTT Chr17:71200872..71200891 60.17 50
downstream ENSMUSE00000692627 Chr17:71200212..71200550 TAAACAAGGTGCTCCGGTCT Chr17:71200347..71200366 59.73 50
downstream ENSMUSE00000606362 Chr17:71195512..71195738 AGAGGCTGCTGATGAGGAAA Chr17:71195634..71195653 60.1 50
downstream ENSMUSE00000716636 Chr17:71195512..71195738 AGAGGCTGCTGATGAGGAAA Chr17:71195634..71195653 60.1 50
downstream ENSMUSE00000714388 Chr17:71193554..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55
downstream ENSMUSE00000606361 Chr17:71193552..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55
downstream ENSMUSE00000717035 Chr17:71193551..71194612 ATCCTGGTTGAGGTCTGGTG Chr17:71194096..71194115 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTCCCGTCCTAGTTTGAA Chr17:71202744..71202764 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTCCCGTCCTAGTTTGAA Chr17:71202744..71202764 59.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CGCTCCGACTTCTTAACTGC Chr17:71202850..71202870 60.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CGCTCCGACTTCTTAACTGC Chr17:71202850..71202870 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047407