Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10837
Trapped Gene
2610101N10Rik (ENSMUSG00000032407)
Vector Insertion
Chr 9: 95374907 - 95375620
Public Clones P149C03 (ggtc) PST14623-NL (escells)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000498028 (Chr9:95375621..95375716 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGTTGCCCCATCAAAATG Chr9:95375656..95375675 59.8 40 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000498028 (Chr9:95375621..95375716 -)
Downstram Exon
ENSMUSE00000491092 (Chr9:95374840..95374906 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGTTGCCCCATCAAAATG Chr9:95375656..95375675 59.8 40 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000219473 Chr9:95412236..95412313 CTCAAGATGGCCGACAAAAC Chr9:95412267..95412286 60.64 50
upstream ENSMUSE00000219468 Chr9:95402959..95403003 No primer for this exon
upstream ENSMUSE00000219475 Chr9:95401107..95401238 CCTTTGCGATTCTCCTCATC Chr9:95401121..95401140 59.77 50
upstream ENSMUSE00000219477 Chr9:95396254..95396352 CAGCAAAGCGAACCCTAAGT Chr9:95396284..95396303 59.52 50
upstream ENSMUSE00000219474 Chr9:95394122..95394236 CGGGGTTGTTAATGCAGCTA Chr9:95394125..95394144 61.01 50
upstream ENSMUSE00000219470 Chr9:95393517..95393650 CCTCCAAATCAGTCATCCAA Chr9:95393560..95393579 58.49 45
upstream ENSMUSE00000513442 Chr9:95392743..95392810 No primer for this exon
upstream ENSMUSE00000219471 Chr9:95391801..95391895 GGCAGGTTAAGTCGGTTTGA Chr9:95391839..95391858 60.11 50
upstream ENSMUSE00000219469 Chr9:95391684..95391719 No primer for this exon
upstream ENSMUSE00000219476 Chr9:95391510..95391592 TGATTATGCACCTGGCTCAC Chr9:95391566..95391585 59.68 50
upstream ENSMUSE00000693972 Chr9:95390509..95390674 TGAAGAAATGCTGTGCCAAG Chr9:95390650..95390669 59.99 45
upstream ENSMUSE00000517875 Chr9:95390119..95390330 TGGGGTAAAGCTGTGCCTAT Chr9:95390276..95390295 59.59 50
upstream ENSMUSE00000518756 Chr9:95389165..95389208 CTGTCGCAAGCCATAGTCAA Chr9:95389186..95389205 60.01 50
upstream ENSMUSE00000521498 Chr9:95385980..95386084 GTTGTACGTGAAGGGCCAAT Chr9:95386028..95386047 59.86 50
upstream ENSMUSE00000514792 Chr9:95384827..95384893 CAGACACCAGCCCATGTTTA Chr9:95384858..95384877 59.57 50
upstream ENSMUSE00000492023 Chr9:95384589..95384752 AGGCCACCACCTTTAAATCC Chr9:95384670..95384689 60.19 50
upstream ENSMUSE00000492971 Chr9:95382511..95382673 GGAGATGCCATGGTTTTCTG Chr9:95382596..95382615 60.46 50
upstream ENSMUSE00000493903 Chr9:95382072..95382151 CTTCAGCCAAAGTTGCCAAT Chr9:95382092..95382111 60.25 45
upstream ENSMUSE00000502555 Chr9:95379686..95379773 ATCGTACAATTCAAGGCCATTT Chr9:95379705..95379726 59.74 36.36
upstream ENSMUSE00000496222 Chr9:95377819..95377941 CGGGTAATGACCTGCTTCAG Chr9:95377919..95377938 60.65 55
upstream ENSMUSE00000497069 Chr9:95376526..95376682 TGATGATCTGGATGGAGTGC Chr9:95376529..95376548 59.59 50
upstream ENSMUSE00000498028 Chr9:95375621..95375716 AAAGTTGCCCCATCAAAATG Chr9:95375656..95375675 59.8 40

*** Putative Vector Insertion (Chr 9: 95374907 - 95375620) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000491092 Chr9:95374840..95374906 No primer for this exon
downstream ENSMUSE00000501266 Chr9:95372462..95372621 CGAAGCTTAGCTCGCTTTTC Chr9:95372450..95372469 59.52 50
downstream ENSMUSE00000502185 Chr9:95366965..95367075 GAAGCTTTGGCCTGGTTTTT Chr9:95366985..95367004 60.59 45
downstream ENSMUSE00000374453 Chr9:95364782..95364900 No primer for this exon
downstream ENSMUSE00000415159 Chr9:95363122..95363298 GGCTGGGGGAGGTACTATGT Chr9:95363248..95363267 60.21 60
downstream ENSMUSE00000415153 Chr9:95360840..95361962 CTAGAGCGAGAGCGCCTAGA Chr9:95361890..95361909 60.15 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGTAATCGCCTTGCAGCAC Chr9:95375552..95375572 59.09 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTGAATTGGAAGCACAAGG Chr9:95375618..95375638 58.85 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTAATCGCCTTGCAGCACAT Chr9:95375647..95375667 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGGATGCAACTGAAGACTCAA Chr9:95375694..95375715 59.43 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032407