Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10843
Trapped Gene
Pop1 (ENSMUSG00000022325)
Vector Insertion
Chr 15: 34425171 - 34429043
Public Clones (sanger) (sanger) (sanger) P079C01 (ggtc) E078A09 (ggtc) D045D12 (ggtc)
P089D04 (ggtc) (ggtc) E035E12 (ggtc) D047C12 (ggtc) H009F06 (ggtc)
(ggtc) E035E12 (ggtc) IST14279B12 (tigm) IST11468G7 (tigm)
Private Clones OST310409 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000422489 (Chr15:34425087..34425170 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGGTGGGAGCTTCTAGG Chr15:34425099..34425118 59.86 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000422489 (Chr15:34425087..34425170 +)
Downstram Exon
ENSMUSE00000254850 (Chr15:34429044..34429187 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGGTGGGAGCTTCTAGG Chr15:34425099..34425118 59.86 60 GTCACGTTACTGGGCTGGTT Chr15:34429110..34429129 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000422489 Chr15:34425087..34425170 CTGTGGTGGGAGCTTCTAGG Chr15:34425099..34425118 59.86 60

*** Putative Vector Insertion (Chr 15: 34425171 - 34429043) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000254850 Chr15:34429044..34429187 GTCACGTTACTGGGCTGGTT Chr15:34429110..34429129 60.03 55
downstream ENSMUSE00000254839 Chr15:34432066..34432233 TGGTTTTGGAGGAAGATTGC Chr15:34432164..34432183 60.05 45
downstream ENSMUSE00000125612 Chr15:34434714..34434889 TCCTGCAACCGTCTAGGAAG Chr15:34434876..34434895 60.39 55
downstream ENSMUSE00000125614 Chr15:34436174..34436422 GTGACATCTTCGGGCTTTGT Chr15:34436245..34436264 60.12 50
downstream ENSMUSE00000125602 Chr15:34437875..34437962 CCTTTCAACTCCAAACAGCAG Chr15:34437911..34437931 59.9 47.62
downstream ENSMUSE00000125610 Chr15:34438359..34438546 CATCCTCTGGGGTCATCCTA Chr15:34438499..34438518 59.88 55
downstream ENSMUSE00000125608 Chr15:34439518..34439774 CACTCTCCCCATCGTCTCTC Chr15:34439686..34439705 59.79 60
downstream ENSMUSE00000125609 Chr15:34440087..34440180 AGTGCGAAAGAGGGCCTATC Chr15:34440142..34440161 60.73 55
downstream ENSMUSE00000125611 Chr15:34441669..34441780 TCCTGCAAGTGTCAGTCCAC Chr15:34441726..34441745 59.87 55
downstream ENSMUSE00000125601 Chr15:34442487..34442606 TGGAATTTCTGCTGGTGATG Chr15:34442515..34442534 59.65 45
downstream ENSMUSE00000368966 Chr15:34442845..34442934 TTCCAATGAGCACAAGACCA Chr15:34442908..34442927 60.24 45
downstream ENSMUSE00000125607 Chr15:34445597..34445712 AGCTGCTTCACTCGCTCATT Chr15:34445621..34445640 60.31 50
downstream ENSMUSE00000125606 Chr15:34447582..34447773 TCACGAGCCCCTAAATCAAG Chr15:34447649..34447668 60.21 50
downstream ENSMUSE00000125605 Chr15:34455918..34456072 ACTCGTGCACCTCGGTAGAT Chr15:34455940..34455959 59.75 55
downstream ENSMUSE00000125604 Chr15:34458638..34458985 GCACCAGGCATTGAAGCTAT Chr15:34458781..34458800 60.24 50
downstream ENSMUSE00000683718 Chr15:34459618..34460402 TTCCACGCAGTTCCACAATA Chr15:34460376..34460395 60.11 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTGGTGGTGAGGCACTAA Chr15:34425171..34425191 60.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCGGAACTTTTGGCAGGTT Chr15:34425155..34425175 61.53 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022325