Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10847
Trapped Gene
Fxyd6 (ENSMUSG00000066705)
Vector Insertion
Chr 9: 45178572 - 45198070
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
D048G04 (ggtc) D173B08 (ggtc) P098E11 (ggtc) D187A12 (ggtc) D037F04 (ggtc)
D048G04 (ggtc) E021E06 (ggtc) D179E07 (ggtc) E021E06 (ggtc) CMHD-GT_331C7-3 (cmhd)
CMHD-GT_437D12-3 (cmhd)
Private Clones OST432638 (lexicon) OST401506 (lexicon) OST338992 (lexicon) OST253215 (lexicon)
OST236306 (lexicon) OST200374 (lexicon) OST194705 (lexicon) OST113550 (lexicon)
OST91886 (lexicon) OST33734 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000535767 (Chr9:45178522..45178571 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000535767 (Chr9:45178522..45178571 +)
Downstram Exon
ENSMUSE00000535764 (Chr9:45198071..45198130 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000535767 Chr9:45178522..45178571 No primer for this exon

*** Putative Vector Insertion (Chr 9: 45178572 - 45198070) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000535764 Chr9:45198071..45198130 No primer for this exon
downstream ENSMUSE00000535762 Chr9:45198717..45198755 No primer for this exon
downstream ENSMUSE00000535757 Chr9:45198860..45198934 CCAATCCTCAGGGTCTGGTA Chr9:45198884..45198903 59.92 55
downstream ENSMUSE00000535752 Chr9:45199644..45199680 GGCTTCTGATTGAAACTGCAC Chr9:45199679..45199699 59.87 47.62
downstream ENSMUSE00000535750 Chr9:45200298..45200347 GTGATGAGGTTCTCCACCTG Chr9:45200342..45200361 58.05 55
downstream ENSMUSE00000535749 Chr9:45200759..45200808 AGGCTGCACCTCAGTTCTCT Chr9:45200800..45200819 59.21 55
downstream ENSMUSE00000535748 Chr9:45203066..45204237 TCCAAGGGAACACATTAGGC Chr9:45204141..45204160 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTCTTCCGAGTGGAGGTA Chr9:45178605..45178625 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TACCACCGATGCCATCTTTC Chr9:45178556..45178576 60.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066705