Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10851
Trapped Gene
Rnf111 (ENSMUSG00000032217)
Vector Insertion
Chr 9: 70324476 - 70350746
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) P104A08 (ggtc) E067G06 (ggtc) D161G02 (ggtc)
D128B04 (ggtc) D088C12 (ggtc) D041F10 (ggtc) D034F08 (ggtc) D005E08 (ggtc)
5SE307G03 (ggtc) (ggtc) (ggtc) P143C11 (ggtc) P127B07 (ggtc)
P120D12 (ggtc) H001A12 (ggtc) E020E11 (ggtc) D144E02 (ggtc) D106H03 (ggtc)
D080H05 (ggtc) D035G08 (ggtc) D022G08 (ggtc) (ggtc) (ggtc)
(ggtc) P027B12 (ggtc) P138D02 (ggtc) P105D11 (ggtc) E121C09 (ggtc)
E001G09 (ggtc) D133C09 (ggtc) D098A09 (ggtc) D044E08 (ggtc) D035F12 (ggtc)
D008C09 (ggtc) 5SE305E03 (ggtc) (ggtc) (ggtc) P146A04 (ggtc)
P128G07 (ggtc) P100E07 (ggtc) E067F12 (ggtc) D161G02 (ggtc) D123E11 (ggtc)
D082F05 (ggtc) D041F10 (ggtc) D027C09 (ggtc) D003E03 (ggtc) 3SE307G03 (ggtc)
(ggtc) (ggtc) (ggtc) D003E03 (ggtc) P143C11 (ggtc) P127B07 (ggtc)
P105E12 (ggtc) H001A12 (ggtc) E020E11 (ggtc) D144E02 (ggtc) D100F05 (ggtc)
D049B02 (ggtc) D035G07 (ggtc) D008D07 (ggtc) (ggtc) (ggtc)
(ggtc) Q007B01 (ggtc) P138D02 (ggtc) P104A08 (ggtc) E120G09 (ggtc)
D186E11 (ggtc) D133A10 (ggtc) D088C12 (ggtc) D044E08 (ggtc) D034F08 (ggtc)
D005E08 (ggtc) 3SE307H03 (ggtc) (ggtc) (ggtc) P145B11 (ggtc)
P128G07 (ggtc) P093E03 (ggtc) E064B07 (ggtc) D160D08 (ggtc) D106H03 (ggtc)
D080H05 (ggtc) D035G08 (ggtc) D027C09 (ggtc) (ggtc) (ggtc)
(ggtc) P138D02 (ggtc) P138H06 (ggtc) P120D12 (ggtc) P105E12 (ggtc)
E125G07 (ggtc) E019A11 (ggtc) D137E06 (ggtc) D098A09 (ggtc) D047H08 (ggtc)
D035F12 (ggtc) D008D07 (ggtc) 5SE305E04 (ggtc) (ggtc) (ggtc)
(ggtc) P146A04 (ggtc) P137E03 (ggtc) (cmhd) CMHD-GT_261D5-3 (cmhd) CMHD-GT_285F2-3 (cmhd)
FHCRC-GT-S5-11C1 (fhcrc) PST7535-NR (escells) PST23182-NR (escells) PST6997-NR (escells)
PST19532-NR (escells) PST8868-NR (escells) PST23319-NR (escells) PST19009-NR (escells)
PST24460-NR (escells) PST9088-NR (escells) PST22646-NR (escells) PSTVU01.J38 (vanderbilt)
IST11597H8 (tigm) IST14378G11 (tigm) IST14858H6 (tigm) IST11585G11 (tigm)
IST14139D9 (tigm) IST14306H8 (tigm) IST14551H6 (tigm) IST10090A10 (tigm)
IST14258F9 (tigm) IST12126C1 (tigm) IST14444C9 (tigm) IST13040H9 (tigm)
IST11801F8 (tigm) IST14161B4 (tigm) IST14965B2 (tigm) IST10928H3 (tigm)
IST14532B2 (tigm) IST14567G7 (tigm) IST13209H10 (tigm) IST11801F8 (tigm)
IST11743D6 (tigm) IST14726D10 (tigm) IST10786G11 (tigm) IST12295A3 (tigm)
IST13087F3 (tigm) IST10979E5 (tigm) IST12295A3 (tigm) IST11547E6 (tigm)
IST14649B7 (tigm) IST14070D1 (tigm) IST14395B11 (tigm) IST14407G11 (tigm)
IST12126C1 (tigm) IST10263H9 (tigm) IST11574F4 (tigm)
Private Clones OST442344 (lexicon) OST432424 (lexicon) OST422396 (lexicon) OST410883 (lexicon)
OST347352 (lexicon) OST323010 (lexicon) OST309304 (lexicon) OST303441 (lexicon)
OST274413 (lexicon) OST260409 (lexicon) OST240615 (lexicon) OST234016 (lexicon)
OST222678 (lexicon) OST208116 (lexicon) OST207453 (lexicon) OST205119 (lexicon)
OST194687 (lexicon) OST191841 (lexicon) OST187888 (lexicon) OST179581 (lexicon)
OST172946 (lexicon) OST170760 (lexicon) OST167624 (lexicon) OST166042 (lexicon)
OST155760 (lexicon) OST136145 (lexicon) OST118642 (lexicon) OST109682 (lexicon)
OST107105 (lexicon) OST78481 (lexicon) OST77825 (lexicon) OST66201 (lexicon)
OST63931 (lexicon) OST60380 (lexicon) OST57509 (lexicon) OST34672 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000318624 (Chr9:70350747..70350809 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGATCGGAGTCAGCAGTG Chr9:70350787..70350806 58.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000318624 (Chr9:70350747..70350809 -)
Downstram Exon
ENSMUSE00000318604 (Chr9:70323583..70324475 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGATCGGAGTCAGCAGTG Chr9:70350787..70350806 58.83 50 ATCGCTGCTGAGGTCATTCT Chr9:70323646..70323665 59.98 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000512819 Chr9:70351266..70351532 GTGTTGACAGACGCCCTCCT Chr9:70351370..70351389 62.65 60
upstream ENSMUSE00000696308 Chr9:70351039..70351161 ATTGTGTCCGGGCAAGAGTC Chr9:70351074..70351093 62.41 55
upstream ENSMUSE00000318624 Chr9:70350747..70350809 ATTGATCGGAGTCAGCAGTG Chr9:70350787..70350806 58.83 50

*** Putative Vector Insertion (Chr 9: 70324476 - 70350746) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000318604 Chr9:70323583..70324475 ATCGCTGCTGAGGTCATTCT Chr9:70323646..70323665 59.98 50
downstream ENSMUSE00000217799 Chr9:70317162..70317288 CAGTGACCTGGGGAGTGAAG Chr9:70317210..70317229 60.7 60
downstream ENSMUSE00000217800 Chr9:70306797..70306960 CGTCCTGTATGCGAACTTGA Chr9:70306873..70306892 59.86 50
downstream ENSMUSE00000217793 Chr9:70305631..70305825 TCAGAGGCTTGCTCAGAGGT Chr9:70305704..70305723 60.28 55
downstream ENSMUSE00000217780 Chr9:70301308..70301624 GGTGTGCTAATGCATGATGG Chr9:70301471..70301490 59.96 50
downstream ENSMUSE00000217807 Chr9:70298093..70298348 TAGTGCCGACATGACGAAAG Chr9:70298085..70298104 59.86 50
downstream ENSMUSE00000217804 Chr9:70291209..70291557 TGATGGTGCAGTGGTCTTGT Chr9:70291505..70291524 60.16 50
downstream ENSMUSE00000217791 Chr9:70290079..70290204 AAGACATGGTTTGAGGCACA Chr9:70290091..70290110 59.14 45
downstream ENSMUSE00000217782 Chr9:70288562..70288688 GCAGAGCACCAGGTGTGTAG Chr9:70288611..70288630 59.49 60
downstream ENSMUSE00000406268 Chr9:70279744..70279836 GTGAGGATAGCCTGCCATGT Chr9:70279788..70279807 60.1 55
downstream ENSMUSE00000217786 Chr9:70278738..70278833 GAGGCTCCACGATTGACATT Chr9:70278762..70278781 60.08 50
downstream ENSMUSE00000217795 Chr9:70277359..70277486 TGCAGTGCAGTTTCCTCTGT Chr9:70277425..70277444 59.62 50
downstream ENSMUSE00000696307 Chr9:70273237..70274914 GGGGCACTTCTTATTGGTGA Chr9:70274820..70274839 59.93 50
downstream ENSMUSE00000386215 Chr9:70273236..70274914 GGGGCACTTCTTATTGGTGA Chr9:70274820..70274839 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGGCTGTTTGTTTCAAAGT Chr9:70341760..70341780 59.08 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGGCTGTTTGTTTCAAAGT Chr9:70341760..70341780 59.08 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACATGCAGAAAGAGGCTGGT Chr9:70341808..70341828 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACATGCAGAAAGAGGCTGGT Chr9:70341808..70341828 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032217