Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10855
Trapped Gene
AC102176.8-201 (ENSMUSG00000063480)
Vector Insertion
Chr 15: 81874448 - 81877916
Public Clones 3SD010C11 (ggtc) P126A01 (ggtc) 5SD094F08 (ggtc) 5SP126A01 (ggtc)
5SD010C11 (ggtc) D010C11 (ggtc) 3SP126A01 (ggtc) CMHD-GT_506G2-3 (cmhd)
IST14609B12 (tigm) IST10916D6 (tigm) IST14163F7 (tigm)
Private Clones OST433416 (lexicon) OST407402 (lexicon) OST406249 (lexicon) OST406248 (lexicon)
OST377529 (lexicon) OST367169 (lexicon) OST337144 (lexicon) OST244807 (lexicon)
OST240237 (lexicon) OST239248 (lexicon) OST185408 (lexicon) OST130365 (lexicon)
OST115785 (lexicon) OST31427 (lexicon) OST23561 (lexicon) OST22017 (lexicon)
OST19174 (lexicon) OST19027 (lexicon) OST16935 (lexicon) OST7877 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000680671 (Chr15:81877917..81877975 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTGAGTTGGGCTGTCGTC Chr15:81877950..81877969 61.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000680671 (Chr15:81877917..81877975 -)
Downstram Exon
ENSMUSE00000556697 (Chr15:81874327..81874447 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTGAGTTGGGCTGTCGTC Chr15:81877950..81877969 61.4 55 TAGGCCTTCGGATTCACATC Chr15:81874397..81874416 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000680671 Chr15:81877917..81877975 TCTTGAGTTGGGCTGTCGTC Chr15:81877950..81877969 61.4 55

*** Putative Vector Insertion (Chr 15: 81874448 - 81877916) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556697 Chr15:81874327..81874447 TAGGCCTTCGGATTCACATC Chr15:81874397..81874416 60.04 50
downstream ENSMUSE00000509796 Chr15:81871770..81872798 CTTGTCTTCGCACAGCAGAG Chr15:81872673..81872692 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGTTGTCTCCATGAGCTTG Chr15:81877917..81877937 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGTTGTCTCCATGAGCTTG Chr15:81877917..81877937 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr15:81874906..81874926 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTCCACGTGACTGGGAAAAC Chr15:81874910..81874930 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063480