Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10856
Trapped Gene
Slc25a36 (ENSMUSG00000032449)
Vector Insertion
Chr 9: 96997600 - 97000493
Public Clones D026E11 (ggtc) D010E05 (ggtc) D010E05 (ggtc) 3SE152A04 (ggtc)
Private Clones OST366439 (lexicon) OST331856 (lexicon) OST225567 (lexicon) OST196976 (lexicon)
OST168686 (lexicon) OST146033 (lexicon) OST139277 (lexicon) OST81995 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000231837 (Chr9:97000494..97000658 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTGGACCTCTTCATTGTC Chr9:97000498..97000517 59.51 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000231837 (Chr9:97000494..97000658 -)
Downstram Exon
ENSMUSE00000583557 (Chr9:96997522..96997599 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTGGACCTCTTCATTGTC Chr9:97000498..97000517 59.51 55 GCCCAATCCTCTAAACAACG Chr9:96997529..96997548 59.57 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000530910 Chr9:97011330..97011576 CTCCGACTCCTCACGACTCT Chr9:97011554..97011573 59.58 60
upstream ENSMUSE00000231837 Chr9:97000494..97000658 CCCTGGACCTCTTCATTGTC Chr9:97000498..97000517 59.51 55

*** Putative Vector Insertion (Chr 9: 96997600 - 97000493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000583557 Chr9:96997522..96997599 GCCCAATCCTCTAAACAACG Chr9:96997529..96997548 59.57 50
downstream ENSMUSE00000583556 Chr9:96993496..96993596 TGCAGTTTGAATAAGCAGCAA Chr9:96993543..96993563 59.64 38.1
downstream ENSMUSE00000219791 Chr9:96985476..96985542 TAAGCCAAATGGGGTTTGTT Chr9:96985482..96985501 59.31 40
downstream ENSMUSE00000530909 Chr9:96984812..96984846 No primer for this exon
downstream ENSMUSE00000219793 Chr9:96980612..96980901 GTGGCACAGGTTTTTGAGGT Chr9:96980610..96980629 60.01 50
downstream ENSMUSE00000332885 Chr9:96978166..96979658 GCTGCTATCCGTTGAGAAGG Chr9:96979439..96979458 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:97000423..97000443 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGTCCCCTGGACCTCTTC Chr9:97000502..97000522 60.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGCACAGTGGGAGCTATTCT Chr9:96997630..96997650 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TGTTCTTCGTGACTGGGAAA Chr9:96997595..96997615 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032449