Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10857
Trapped Gene
Ccdc58 (ENSMUSG00000075229)
Vector Insertion
Chr 16: 36072224 - 36082776
Public Clones P066E10 (ggtc) (ggtc) D016A12 (ggtc) D016A12 (ggtc) PST20816-NR (escells)
IST14140A7 (tigm) IST15051E7 (tigm) IST14301D6 (tigm) IST14253C10 (tigm)
IST14434D11 (tigm) IST14586B7 (tigm) IST14340A7 (tigm) IST14583C3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000644041 (Chr16:36072173..36072223 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGAAGAGTTCGCCGAGT Chr16:36072199..36072218 60.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000644041 (Chr16:36072173..36072223 +)
Downstram Exon
ENSMUSE00000644039 (Chr16:36082777..36082902 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGAAGAGTTCGCCGAGT Chr16:36072199..36072218 60.59 55 AGGAAGCTGTTGGAACCGTA Chr16:36082855..36082874 59.73 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644041 Chr16:36072173..36072223 CTGTGAAGAGTTCGCCGAGT Chr16:36072199..36072218 60.59 55

*** Putative Vector Insertion (Chr 16: 36072224 - 36082776) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000644039 Chr16:36082777..36082902 AGGAAGCTGTTGGAACCGTA Chr16:36082855..36082874 59.73 50
downstream ENSMUSE00000644038 Chr16:36085103..36085249 CTGACATGAGCTGCCATCAA Chr16:36085125..36085144 60.99 50
downstream ENSMUSE00000644037 Chr16:36089987..36090046 No primer for this exon
downstream ENSMUSE00000644036 Chr16:36091920..36092204 GCGATGAGATGACCGAGTCT Chr16:36092009..36092028 60.38 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGAGGGAGGGAATTAGT Chr16:36081188..36081208 59.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAGGGAGGGAATTAGT Chr16:36081188..36081208 59.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000075229