Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10860
Trapped Gene
Cox8a (ENSMUSG00000035885)
Vector Insertion
Chr 19: 7289975 - 7291888
Public Clones (sanger) (sanger) G053F05 (ggtc) P075H08 (ggtc) G048E03 (ggtc)
CMHD-GT_427B9-3 (cmhd) CMHD-GT_535G10-3 (cmhd) (cmhd) CMHD-GT_410A4-3 (cmhd)
CMHD-GT_533G6-3 (cmhd) IST13053A10 (tigm)
Private Clones OST386350 (lexicon) OST378979 (lexicon) OST364602 (lexicon) OST233109 (lexicon)
OST43285 (lexicon) OST37468 (lexicon) OST22432 (lexicon) OST1120 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346434 (Chr19:7291889..7292056 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGACCTTGGACTGGTCCTC Chr19:7292026..7292045 59.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346434 (Chr19:7291889..7292056 -)
Downstram Exon
ENSMUSE00000239800 (Chr19:7289653..7289974 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGACCTTGGACTGGTCCTC Chr19:7292026..7292045 59.68 60 TCGAGAGGTCATGATTGCAG Chr19:7289717..7289736 59.94 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000346434 Chr19:7291889..7292056 CTGACCTTGGACTGGTCCTC Chr19:7292026..7292045 59.68 60

*** Putative Vector Insertion (Chr 19: 7289975 - 7291888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000239800 Chr19:7289653..7289974 TCGAGAGGTCATGATTGCAG Chr19:7289717..7289736 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr19:7291818..7291838 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTGGTAGCCTGCGTGACT Chr19:7291830..7291850 61.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACTCCCTGACCTTGGACTG Chr19:7292030..7292050 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GACTCCCTGACCTTGGACTG Chr19:7292030..7292050 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035885