Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10863
Trapped Gene
Rrp1b (ENSMUSG00000058392)
Vector Insertion
Chr 17: 32196283 - 32197292
Public Clones P125C08 (ggtc) P125C08 (ggtc) P125C08 (ggtc) CMHD-GT_345A12-3 (cmhd) PST4330-NR (escells)
PST14368-NR (escells) PST2255-NR (escells) PST10519-NR (escells) PST14950-NR (escells)
PST8311-NR (escells) PST13988-NR (escells) PST2292-NR (escells) PST4361-NR (escells)
PST4330-NL (escells) PST2400-NR (escells) PST12464-NR (escells) PST3758-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000312742 (Chr17:32196219..32196282 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACACCCTCCAGTTCCAAGA Chr17:32196227..32196246 59.55 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000312742 (Chr17:32196219..32196282 +)
Downstram Exon
ENSMUSE00000609261 (Chr17:32197293..32197547 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACACCCTCCAGTTCCAAGA Chr17:32196227..32196246 59.55 50 GGGGCTGACCAGGATACTCT Chr17:32197333..32197352 60.48 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000547752 Chr17:32173107..32173549 CAACTAACCGCCCTGTCAAT Chr17:32173189..32173208 59.99 50
upstream ENSMUSE00000313039 Chr17:32182874..32182956 No primer for this exon
upstream ENSMUSE00000313011 Chr17:32184619..32184676 CCCAACTCATCCACGTTGTA Chr17:32184641..32184660 59.42 50
upstream ENSMUSE00000547741 Chr17:32185498..32185583 ATGAATCGAGAGTGGCAAGG Chr17:32185530..32185549 60.22 50
upstream ENSMUSE00000312955 Chr17:32186371..32186432 GAAGTTCTCAAGCGGAATGC Chr17:32186401..32186420 59.96 50
upstream ENSMUSE00000312926 Chr17:32186894..32187023 GCGTGAGAACCCACTTGATT Chr17:32186962..32186981 60.12 50
upstream ENSMUSE00000312898 Chr17:32188091..32188155 CTTAGCGGACCAGAACCTCA Chr17:32188093..32188112 60.39 55
upstream ENSMUSE00000312877 Chr17:32188628..32188794 GTAGCGAGGGGTGTTTTTGA Chr17:32188647..32188666 60.11 50
upstream ENSMUSE00000312854 Chr17:32189684..32189772 GACATCTGTGCAGCCTTGAA Chr17:32189731..32189750 59.99 50
upstream ENSMUSE00000137510 Chr17:32190802..32190899 GCTGATCGACTCCTGGAAAT Chr17:32190820..32190839 59.24 50
upstream ENSMUSE00000479782 Chr17:32192050..32192069 No primer for this exon
upstream ENSMUSE00000137513 Chr17:32192856..32192942 AGGACAACGGTCAGAGAAGG Chr17:32192883..32192902 59.3 55
upstream ENSMUSE00000312778 Chr17:32193501..32194201 CAAAGTACCGGATTCGGAGA Chr17:32193625..32193644 60.07 50
upstream ENSMUSE00000312759 Chr17:32195469..32195609 GAAAACGGAGGACGACTTTG Chr17:32195498..32195517 59.71 50
upstream ENSMUSE00000312742 Chr17:32196219..32196282 AACACCCTCCAGTTCCAAGA Chr17:32196227..32196246 59.55 50

*** Putative Vector Insertion (Chr 17: 32196283 - 32197292) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000609261 Chr17:32197293..32197547 GGGGCTGACCAGGATACTCT Chr17:32197333..32197352 60.48 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGGACCAACCAGCTAGAG Chr17:32196313..32196333 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGGACCAACCAGCTAGAG Chr17:32196313..32196333 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058392