Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10865
Trapped Gene
Idh3g (ENSMUSG00000002010)
Vector Insertion
Chr X: 71028056 - 71032113
Public Clones (sanger) P105C10 (ggtc) IST14735D3 (tigm) IST14139H11 (tigm) IST14871E7 (tigm)
Private Clones OST327778 (lexicon) OST66301 (lexicon) OST45705 (lexicon) OST38334 (lexicon)
OST32605 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343243 (ChrX:71032114..71032204 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343243 (ChrX:71032114..71032204 -)
Downstram Exon
ENSMUSE00000271758 (ChrX:71028014..71028055 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000343243 ChrX:71032114..71032204 No primer for this exon

*** Putative Vector Insertion (Chr X: 71028056 - 71032113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000271758 ChrX:71028014..71028055 No primer for this exon
downstream ENSMUSE00000655218 ChrX:71027637..71027648 No primer for this exon
downstream ENSMUSE00000208970 ChrX:71027345..71027442 No primer for this exon
downstream ENSMUSE00000208952 ChrX:71027016..71027128 No primer for this exon
downstream ENSMUSE00000208965 ChrX:71026491..71026551 No primer for this exon
downstream ENSMUSE00000208954 ChrX:71026237..71026369 No primer for this exon
downstream ENSMUSE00000208967 ChrX:71025913..71026046 No primer for this exon
downstream ENSMUSE00000208969 ChrX:71025552..71025654 No primer for this exon
downstream ENSMUSE00000208963 ChrX:71025316..71025462 No primer for this exon
downstream ENSMUSE00000208964 ChrX:71024953..71025047 No primer for this exon
downstream ENSMUSE00000208958 ChrX:71024805..71024865 No primer for this exon
downstream ENSMUSE00000384240 ChrX:71024306..71024510 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGGGTGAGTGGCAAAGAAT ChrX:71029068..71029088 59.41 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGGGTGAGTGGCAAAGAAT ChrX:71029068..71029088 59.41 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TGAAAGTAATCGCCTTGCAG ChrX:71029140..71029160 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GAAAGCGTGACTGGGAAAAC ChrX:71029139..71029159 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002010