Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10874
Trapped Gene
Ubap2 (ENSMUSG00000028433)
Vector Insertion
Chr 4: 41143360 - 41143567
Public Clones P098C02 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000179127 (Chr4:41143361..41143566 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGTTTGGCCGAGGAGACT Chr4:41143537..41143556 60.25 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000179127 (Chr4:41143361..41143566 -)
Downstram Exon
ENSMUSE00000675439 (Chr4:41143361..41143566 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGTTTGGCCGAGGAGACT Chr4:41143537..41143556 60.25 50 AGTAGGGGAGGCCGGTATAG Chr4:41143383..41143402 59.46 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513201 Chr4:41222073..41222168 CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50
upstream ENSMUSE00000675458 Chr4:41222073..41222177 CCGCTTTGTAAGAGGCACAT Chr4:41222129..41222148 60.27 50
upstream ENSMUSE00000711075 Chr4:41198568..41198704 CTCGGGAAAAACCACAGATG Chr4:41198610..41198629 60.49 50
upstream ENSMUSE00000714065 Chr4:41198568..41198704 CTCGGGAAAAACCACAGATG Chr4:41198610..41198629 60.49 50
upstream ENSMUSE00000718657 Chr4:41198568..41198704 CTCGGGAAAAACCACAGATG Chr4:41198610..41198629 60.49 50
upstream ENSMUSE00000675430 Chr4:41192489..41192525 No primer for this exon
upstream ENSMUSE00000179088 Chr4:41182550..41182627 CGGCTTGCTCAAGTGATCTT Chr4:41182590..41182609 60.54 50
upstream ENSMUSE00000179110 Chr4:41180637..41180747 ATCGTGGCCCTACATGACTG Chr4:41180692..41180711 60.94 55
upstream ENSMUSE00000179130 Chr4:41176728..41176881 GAGAGAAGCGAGTCGTGGAC Chr4:41176776..41176795 60.14 60
upstream ENSMUSE00000295141 Chr4:41174232..41174309 ACTGCAGCCAAGGAGACAAG Chr4:41174266..41174285 60.59 55
upstream ENSMUSE00000295135 Chr4:41173313..41173367 GGAAGGTTCTCCGCTCAAAG Chr4:41173319..41173338 61.26 55
upstream ENSMUSE00000295127 Chr4:41170389..41170492 GATGGCTGTGGGACAAAGTT Chr4:41170433..41170452 59.97 50
upstream ENSMUSE00000714408 Chr4:41168589..41168654 CTCAGGAACCGCCAAGTAAA Chr4:41168608..41168627 60.24 50
upstream ENSMUSE00000718362 Chr4:41168589..41168654 CTCAGGAACCGCCAAGTAAA Chr4:41168608..41168627 60.24 50
upstream ENSMUSE00000295116 Chr4:41165344..41165396 TGCCTGGAAGAATTCTGTGG Chr4:41165376..41165395 61.18 50
upstream ENSMUSE00000675428 Chr4:41165344..41165396 TGCCTGGAAGAATTCTGTGG Chr4:41165376..41165395 61.18 50
upstream ENSMUSE00000179137 Chr4:41163599..41163666 TCCAGCAGAGAACCATGTCA Chr4:41163612..41163631 60.4 50
upstream ENSMUSE00000675427 Chr4:41163599..41163666 TCCAGCAGAGAACCATGTCA Chr4:41163612..41163631 60.4 50
upstream ENSMUSE00000675455 Chr4:41160783..41160847 TGGGCCAAGGTAACAACTTC Chr4:41160794..41160813 59.97 50
upstream ENSMUSE00000179122 Chr4:41158738..41158927 CAACAATCAGATGGCACCAG Chr4:41158785..41158804 60.11 50
upstream ENSMUSE00000675426 Chr4:41158738..41158927 CAACAATCAGATGGCACCAG Chr4:41158785..41158804 60.11 50
upstream ENSMUSE00000179086 Chr4:41156386..41156602 GCTCAGGATTTGGAGAGCTG Chr4:41156570..41156589 60.1 55
upstream ENSMUSE00000675425 Chr4:41156386..41156602 GCTCAGGATTTGGAGAGCTG Chr4:41156570..41156589 60.1 55
upstream ENSMUSE00000675424 Chr4:41153866..41154137 GCAGACTTTTGCAGCTTCCT Chr4:41153956..41153975 59.76 50
upstream ENSMUSE00000711477 Chr4:41153866..41154137 GCAGACTTTTGCAGCTTCCT Chr4:41153956..41153975 59.76 50
upstream ENSMUSE00000717168 Chr4:41153866..41154137 GCAGACTTTTGCAGCTTCCT Chr4:41153956..41153975 59.76 50
upstream ENSMUSE00000179096 Chr4:41153186..41153358 GAGCCATCGCTCTCTGAGTT Chr4:41153255..41153274 59.71 55
upstream ENSMUSE00000675452 Chr4:41153186..41153358 GAGCCATCGCTCTCTGAGTT Chr4:41153255..41153274 59.71 55
upstream ENSMUSE00000179115 Chr4:41152557..41152770 TCCCAATGACCAGTGCTGTA Chr4:41152731..41152750 60.11 50
upstream ENSMUSE00000675451 Chr4:41152557..41152770 TCCCAATGACCAGTGCTGTA Chr4:41152731..41152750 60.11 50
upstream ENSMUSE00000179148 Chr4:41150566..41150605 GTGGTCGAAGTCAGCACACA Chr4:41150573..41150592 60.95 55
upstream ENSMUSE00000675450 Chr4:41150566..41150605 GTGGTCGAAGTCAGCACACA Chr4:41150573..41150592 60.95 55
upstream ENSMUSE00000179118 Chr4:41149307..41149490 CGTTCCAGCTCCAAAGAAGA Chr4:41149461..41149480 60.51 50
upstream ENSMUSE00000675448 Chr4:41149307..41149490 CGTTCCAGCTCCAAAGAAGA Chr4:41149461..41149480 60.51 50
upstream ENSMUSE00000179129 Chr4:41148497..41148566 CCAGAACAGCATGACCTCTG Chr4:41148532..41148551 59.42 55
upstream ENSMUSE00000675447 Chr4:41148497..41148566 CCAGAACAGCATGACCTCTG Chr4:41148532..41148551 59.42 55
upstream ENSMUSE00000179123 Chr4:41146749..41146935 AGCATGAGCACTGTGAGCAG Chr4:41146820..41146839 60.37 55
upstream ENSMUSE00000675445 Chr4:41146749..41146935 AGCATGAGCACTGTGAGCAG Chr4:41146820..41146839 60.37 55
upstream ENSMUSE00000179094 Chr4:41146527..41146618 CCTCCCCTGCTACACAATCA Chr4:41146567..41146586 61.06 55
upstream ENSMUSE00000675443 Chr4:41146527..41146618 CCTCCCCTGCTACACAATCA Chr4:41146567..41146586 61.06 55
upstream ENSMUSE00000179128 Chr4:41146251..41146298 CGGTTATGATGAGCTCCAGA Chr4:41146274..41146293 58.82 50
upstream ENSMUSE00000675441 Chr4:41146251..41146298 CGGTTATGATGAGCTCCAGA Chr4:41146274..41146293 58.82 50
upstream ENSMUSE00000179117 Chr4:41143763..41143841 AGCCGAGATGGGAATCTAGC Chr4:41143780..41143799 60.7 55
upstream ENSMUSE00000675440 Chr4:41143763..41143841 AGCCGAGATGGGAATCTAGC Chr4:41143780..41143799 60.7 55
upstream ENSMUSE00000179127 Chr4:41143361..41143566 AAAGTTTGGCCGAGGAGACT Chr4:41143537..41143556 60.25 50
upstream ENSMUSE00000675439 Chr4:41143361..41143566 AAAGTTTGGCCGAGGAGACT Chr4:41143537..41143556 60.25 50

*** Putative Vector Insertion (Chr 4: 41143360 - 41143567) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000179114 Chr4:41142977..41143076 No primer for this exon
downstream ENSMUSE00000675437 Chr4:41142977..41143076 No primer for this exon
downstream ENSMUSE00000179120 Chr4:41142779..41142886 GCCACCCTTGGTGTAGTCTC Chr4:41142812..41142831 59.58 60
downstream ENSMUSE00000675435 Chr4:41142779..41142886 GCCACCCTTGGTGTAGTCTC Chr4:41142812..41142831 59.58 60
downstream ENSMUSE00000179135 Chr4:41142641..41142705 AGGTAAGCCAGTGCCTGAAG Chr4:41142652..41142671 59.5 55
downstream ENSMUSE00000675434 Chr4:41142641..41142705 AGGTAAGCCAGTGCCTGAAG Chr4:41142652..41142671 59.5 55
downstream ENSMUSE00000179082 Chr4:41142367..41142558 TGAAATCCCTGCTTGTCAAA Chr4:41142514..41142533 59.25 40
downstream ENSMUSE00000675433 Chr4:41142367..41142558 TGAAATCCCTGCTTGTCAAA Chr4:41142514..41142533 59.25 40
downstream ENSMUSE00000380981 Chr4:41141349..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50
downstream ENSMUSE00000675432 Chr4:41141349..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50
downstream ENSMUSE00000675457 Chr4:41141346..41142279 TGCTGGACAGGGGTTATTTC Chr4:41141634..41141653 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTTTCCCCTGGTAATACA Chr4:41143584..41143604 58.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAAAGTTTGGCCGAGGAGA Chr4:41143537..41143557 62.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028433