Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10878
Trapped Gene
Skp1a (ENSMUSG00000036309)
Vector Insertion
Chr 11: 52050338 - 52050436
Public Clones D021A06 (ggtc) CMHD-GT_535D12-3 (cmhd)
Private Clones OST318093 (lexicon) OST313547 (lexicon) OST252819 (lexicon) OST248877 (lexicon)
OST130679 (lexicon) OST7092 (lexicon) OST1441 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000292755 (Chr11:52050339..52050435 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000292755 (Chr11:52050339..52050435 +)
Downstram Exon
ENSMUSE00000710103 (Chr11:52050339..52050435 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678943 Chr11:52045539..52045620 TGGCCTTGTTCTCGATACTTC Chr11:52045542..52045562 59.33 47.62
upstream ENSMUSE00000678940 Chr11:52045691..52046114 TCTGGCGTCAATTAGCTCCT Chr11:52046060..52046079 59.98 50

*** Putative Vector Insertion (Chr 11: 52050338 - 52050436) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000292755 Chr11:52050339..52050435 No primer for this exon
downstream ENSMUSE00000710103 Chr11:52050339..52050435 No primer for this exon
downstream ENSMUSE00000579923 Chr11:52051753..52051835 GTCTTCAAGAGCATCTGATCCA Chr11:52051788..52051809 59.43 45.46
downstream ENSMUSE00000292750 Chr11:52056089..52056162 No primer for this exon
downstream ENSMUSE00000292744 Chr11:52057117..52057260 GGAGGGTCATCTTTGTGGTG Chr11:52057157..52057176 60.36 55
downstream ENSMUSE00000292739 Chr11:52058483..52058623 CATATTGGCCACAGTCTTGC Chr11:52058548..52058567 59.15 50
downstream ENSMUSE00000653682 Chr11:52059487..52060360 GTTTCTCCACCTGGGAACAA Chr11:52060225..52060244 59.94 50
downstream ENSMUSE00000706076 Chr11:52059487..52059748 TGAAGACAAGGCGATGTTTG Chr11:52059638..52059657 59.84 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAGTTGTAATCGCCTTGC Chr11:52050381..52050401 58.92 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGCGTGACTGGGAAAAC Chr11:52050384..52050404 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036309