Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10881
Trapped Gene
Enc1 (ENSMUSG00000041773)
Vector Insertion
Chr 13: 98011485 - 98014925
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) P103B07 (ggtc)
H011H03 (ggtc) P091D03 (ggtc) D042C12 (ggtc) P094H12 (ggtc) P094H12 (ggtc)
D185E09 (ggtc) H011H03 (ggtc) P089C06 (ggtc) D185E09 (ggtc) P103B07 (ggtc)
PST22493-NR (escells) PST5978-NR (escells) PST18305-NR (escells) IST14999D4 (tigm)
IST14341G2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000450084 (Chr13:98011060..98011484 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAGCAGCAGATCCGGAGAC Chr13:98011275..98011294 59.98 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000450084 (Chr13:98011060..98011484 +)
Downstram Exon
ENSMUSE00000296933 (Chr13:98014926..98016739 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAGCAGCAGATCCGGAGAC Chr13:98011275..98011294 59.98 60 CTTTCGTCTTCCGTCTCCAG Chr13:98015564..98015583 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000450084 Chr13:98011060..98011484 GTAGCAGCAGATCCGGAGAC Chr13:98011275..98011294 59.98 60

*** Putative Vector Insertion (Chr 13: 98011485 - 98014925) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000296933 Chr13:98014926..98016739 CTTTCGTCTTCCGTCTCCAG Chr13:98015564..98015583 59.98 55
downstream ENSMUSE00000296921 Chr13:98020492..98022988 AGCAGCCGAGACCAAAGTTA Chr13:98021526..98021545 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCATTTTAAGTGGCCTGT Chr13:98011482..98011502 60.5 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCATTTTAAGTGGCCTGT Chr13:98011482..98011502 60.5 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041773