Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10883
Trapped Gene
Kank2 (ENSMUSG00000032194)
Vector Insertion
Chr 9: 21600639 - 21602925
Public Clones P149G05 (ggtc) P138D09 (ggtc) E059G03 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000389762 (Chr9:21602926..21602979 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000389762 (Chr9:21602926..21602979 -)
Downstram Exon
ENSMUSE00000702625 (Chr9:21600524..21600638 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGTGGTTGCTCCTCAGATG Chr9:21600546..21600565 59.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389762 Chr9:21602926..21602979 No primer for this exon

*** Putative Vector Insertion (Chr 9: 21600639 - 21602925) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702625 Chr9:21600524..21600638 CTGTGGTTGCTCCTCAGATG Chr9:21600546..21600565 59.42 55
downstream ENSMUSE00000393980 Chr9:21598901..21600127 CCACTGAGTACGGTGGGTCT Chr9:21600040..21600059 60.03 60
downstream ENSMUSE00000217598 Chr9:21585004..21585147 CAGGGTTCTCAGGCTGTACC Chr9:21585066..21585085 59.72 60
downstream ENSMUSE00000217595 Chr9:21584823..21584913 TGGAGGTTCCTCTGGTTGAC Chr9:21584822..21584841 60.09 55
downstream ENSMUSE00000217601 Chr9:21584145..21584381 TCTCTGTGCTCTCGTGTTCG Chr9:21584298..21584317 60.33 55
downstream ENSMUSE00000217592 Chr9:21580145..21580232 GGTATTTCTCCAGGGCCAAG Chr9:21580158..21580177 60.82 55
downstream ENSMUSE00000411828 Chr9:21578977..21579196 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55
downstream ENSMUSE00000702616 Chr9:21578977..21579196 AGCCACTCCTGAAGCACTGT Chr9:21579140..21579159 60.06 55
downstream ENSMUSE00000376094 Chr9:21577189..21577331 CTCAATGTCGTCCTGGGTCT Chr9:21577218..21577237 60.11 55
downstream ENSMUSE00000702615 Chr9:21577189..21577331 CTCAATGTCGTCCTGGGTCT Chr9:21577218..21577237 60.11 55
downstream ENSMUSE00000337246 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000702614 Chr9:21574370..21574570 GATCTCCTTGTGTCCGTGCT Chr9:21574399..21574418 60.27 55
downstream ENSMUSE00000356457 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000702613 Chr9:21574198..21574287 GTTCATGCGTGAGTACAGCA Chr9:21574188..21574207 58.44 50
downstream ENSMUSE00000394948 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55
downstream ENSMUSE00000584853 Chr9:21571233..21573448 AGAGACTGGTGGGTGTTTGG Chr9:21571352..21571371 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTACTCTTAATCGCCTTGC Chr9:21602862..21602883 60.37 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCGTGACTGGGAAAACC Chr9:21602858..21602878 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTTAATCGCCTTGCAGCACA Chr9:21602911..21602931 62.27 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGCGTCGTGACTGGGAAAAC Chr9:21602914..21602934 62.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032194