Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10886
Trapped Gene
Msh6 (ENSMUSG00000005370)
Vector Insertion
Chr 17: 88374746 - 88379530
Public Clones (sanger) (sanger) D047B03 (ggtc) P121F04 (ggtc) E039F03 (ggtc)
D044E11 (ggtc) D001C05 (ggtc) P004D05 (ggtc) E128F08 (ggtc) D134A12 (ggtc)
D034B07 (ggtc) P120G10 (ggtc) E043F03 (ggtc) D047B03 (ggtc) D028D03 (ggtc)
3SE284F10 (ggtc) P029E03 (ggtc) P103F04 (ggtc) E039C12 (ggtc) D042C05 (ggtc)
D001C05 (ggtc) M066C02 (ggtc) E057H01 (ggtc) D134A12 (ggtc) D034B07 (ggtc)
D028D03 (ggtc) P132G03 (ggtc) E043F03 (ggtc) D047B03 (ggtc) D028D03 (ggtc)
P064F12 (ggtc) P103F04 (ggtc) E021C11 (ggtc) D038E03 (ggtc) W173F02 (ggtc)
E054E03 (ggtc) D094H03 (ggtc) D029G12 (ggtc) 5SE284F10 (ggtc) CMHD-GT_460H9-3 (cmhd)
IST14393H2 (tigm) IST12079B3 (tigm) IST13096D12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000515071 (Chr17:88374424..88374745 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000515071 (Chr17:88374424..88374745 +)
Downstram Exon
ENSMUSE00000138802 (Chr17:88379531..88379730 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000515071 Chr17:88374424..88374745 No primer for this exon

*** Putative Vector Insertion (Chr 17: 88374746 - 88379530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138802 Chr17:88379531..88379730 No primer for this exon
downstream ENSMUSE00000138805 Chr17:88382785..88382954 No primer for this exon
downstream ENSMUSE00000239692 Chr17:88383786..88386321 No primer for this exon
downstream ENSMUSE00000138797 Chr17:88387526..88387794 No primer for this exon
downstream ENSMUSE00000138804 Chr17:88388484..88388601 No primer for this exon
downstream ENSMUSE00000138806 Chr17:88388767..88388856 No primer for this exon
downstream ENSMUSE00000138795 Chr17:88389534..88389688 No primer for this exon
downstream ENSMUSE00000138793 Chr17:88389771..88389970 No primer for this exon
downstream ENSMUSE00000239566 Chr17:88390064..88390403 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTCCCGGAAGGAGTAAT Chr17:88374781..88374801 59.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000005370