Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10888
Trapped Gene
Eif2a (ENSMUSG00000027810)
Vector Insertion
Chr 3: 58330009 - 58335008
Public Clones P015E12 (ggtc) P120B10 (ggtc) P016F05 (ggtc) D125G12 (ggtc) P120B10 (ggtc)
W216C03 (ggtc) IST14983E2 (tigm) IST11607D2 (tigm)
Private Clones OST333015 (lexicon) OST330903 (lexicon) OST330177 (lexicon) OST65849 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639198 (Chr3:58329788..58330008 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACACCGACTCGCAGACTTT Chr3:58329878..58329897 59.91 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639198 (Chr3:58329788..58330008 +)
Downstram Exon
ENSMUSE00000255167 (Chr3:58335009..58335078 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACACCGACTCGCAGACTTT Chr3:58329878..58329897 59.91 50 TGTGAAGTGTGGTGGTCCAT Chr3:58335061..58335080 59.85 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639198 Chr3:58329788..58330008 AACACCGACTCGCAGACTTT Chr3:58329878..58329897 59.91 50

*** Putative Vector Insertion (Chr 3: 58330009 - 58335008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000255167 Chr3:58335009..58335078 TGTGAAGTGTGGTGGTCCAT Chr3:58335061..58335080 59.85 50
downstream ENSMUSE00000255157 Chr3:58341456..58341530 GCAAACAATGTCCCATCCTT Chr3:58341515..58341534 59.8 45
downstream ENSMUSE00000255150 Chr3:58343450..58343568 TCCCTTGTTAGCGACATTGA Chr3:58343483..58343502 59.27 45
downstream ENSMUSE00000173227 Chr3:58344962..58345061 ACGATTTCAAACATGCTCCA Chr3:58345039..58345058 59.13 40
downstream ENSMUSE00000173230 Chr3:58345556..58345638 TTAACATTCCGGGCACAAAT Chr3:58345606..58345625 60.19 40
downstream ENSMUSE00000173219 Chr3:58348917..58348990 GGTTGGGTTCCAGGTGATAA Chr3:58348986..58349005 59.65 50
downstream ENSMUSE00000173213 Chr3:58349150..58349294 ATGAGGGGGCACCTTTACTT Chr3:58349192..58349211 59.83 50
downstream ENSMUSE00000173215 Chr3:58349422..58349538 TGGCTATTACCAGCACAGCA Chr3:58349448..58349467 60.42 50
downstream ENSMUSE00000173228 Chr3:58352315..58352886 GGCTATAGAAGGCTGCGTTG Chr3:58352476..58352495 60 55
downstream ENSMUSE00000173231 Chr3:58356491..58356604 TGGCTTGTCACTTCCTGGAT Chr3:58356547..58356566 60.66 50
downstream ENSMUSE00000173233 Chr3:58359457..58359573 TAGGAGCCGCATCACTTCTT Chr3:58359484..58359503 59.98 50
downstream ENSMUSE00000173229 Chr3:58360495..58360560 GCCTGCTCTTTTAGCTGCTC Chr3:58360532..58360551 59.5 55
downstream ENSMUSE00000392131 Chr3:58361043..58361341 ATGGCAATTCCATGAACACC Chr3:58361191..58361210 60.59 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr3:58333059..58333079 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTTCTTTCTGCGTGACTGG Chr3:58333048..58333069 59.87 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027810