Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10890
Trapped Gene
Rbbp4 (ENSMUSG00000057236)
Vector Insertion
Chr 4: 129011889 - 129012461
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) D031A04 (ggtc) E057G07 (ggtc) IST14513B8 (tigm)
Private Clones OST280588 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000662048 (Chr4:129012462..129012584 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000662048 (Chr4:129012462..129012584 -)
Downstram Exon
ENSMUSE00000662047 (Chr4:129011741..129011888 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTCGTTGATCACCCGTTCTT Chr4:129011826..129011845 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662048 Chr4:129012462..129012584 No primer for this exon

*** Putative Vector Insertion (Chr 4: 129011889 - 129012461) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000662047 Chr4:129011741..129011888 CTCGTTGATCACCCGTTCTT Chr4:129011826..129011845 60.11 50
downstream ENSMUSE00000474672 Chr4:129005832..129005977 AAGCCGATGAATGCTGAAAT Chr4:129005922..129005941 59.67 40
downstream ENSMUSE00000182353 Chr4:128999940..129000113 AATGATGCAGGGGTTCTGAG Chr4:128999982..129000001 60.07 50
downstream ENSMUSE00000182364 Chr4:128999597..128999712 AAGTGCCCACTGAGATTTGG Chr4:128999597..128999616 60.11 50
downstream ENSMUSE00000182362 Chr4:128999323..128999483 GTCTTTGCATCCACCACCTT Chr4:128999400..128999419 59.97 50
downstream ENSMUSE00000411932 Chr4:128999098..128999224 TGTGTGAGCATCAACCGAGT Chr4:128999145..128999164 60.32 50
downstream ENSMUSE00000364055 Chr4:128997713..128997790 GGGATTCAAAGGAGTGCAAC Chr4:128997711..128997730 59.53 50
downstream ENSMUSE00000182356 Chr4:128995688..128995764 ACGATCGGTACCACTGGAAG Chr4:128995689..128995708 59.99 55
downstream ENSMUSE00000182368 Chr4:128995106..128995163 CATCTTCTGGGGACTGCTCT Chr4:128995110..128995129 59.4 55
downstream ENSMUSE00000467517 Chr4:128994892..128995002 AACAAATCACCCAAGGCTCA Chr4:128994908..128994927 60.49 45
downstream ENSMUSE00000662046 Chr4:128986762..128987401 GGGCTTGTAGCATTGTTGGT Chr4:128987180..128987199 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTGACAAGGAAGGTGAGT Chr4:129012454..129012474 59.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTGACAAGGAAGGTGAGT Chr4:129012454..129012474 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TAATCGCCTTGCAGCACATC Chr4:129012514..129012534 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000057236