Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10898
Trapped Gene
Armet (ENSMUSG00000032575)
Vector Insertion
Chr 9: 106793530 - 106794144
Public Clones W242E03 (ggtc) P098G08 (ggtc) P098G08 (ggtc)
Private Clones OST356500 (lexicon) OST234299 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000258780 (Chr9:106794145..106794243 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAGGAGGATGTGGGCTAC Chr9:106794219..106794238 59.68 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000258780 (Chr9:106794145..106794243 -)
Downstram Exon
ENSMUSE00000508048 (Chr9:106793402..106793529 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAGGAGGATGTGGGCTAC Chr9:106794219..106794238 59.68 60 CTTGCTTCACGGCAAAACTT Chr9:106793399..106793418 60.42 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000258780 Chr9:106794145..106794243 CTGAGGAGGATGTGGGCTAC Chr9:106794219..106794238 59.68 60

*** Putative Vector Insertion (Chr 9: 106793530 - 106794144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000508048 Chr9:106793402..106793529 CTTGCTTCACGGCAAAACTT Chr9:106793399..106793418 60.42 45
downstream ENSMUSE00000220968 Chr9:106792492..106792633 GGCTTCGACACCTCATTGAT Chr9:106792550..106792569 60.08 50
downstream ENSMUSE00000634487 Chr9:106791092..106791556 AGCAGGAATTGGGCAGACTA Chr9:106791333..106791352 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr9:106794076..106794096 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAGCGTGACTGGGAAAAC Chr9:106794078..106794098 59.72 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGAGGAGGATGTGGGCTAC Chr9:106794217..106794237 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGAGGAGGATGTGGGCTAC Chr9:106794217..106794237 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032575