Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10969
Trapped Gene
Ubb (ENSMUSG00000019505)
Vector Insertion
Chr 11: 62365098 - 62365641
Public Clones P138C07 (ggtc) 3SP136E09 (ggtc) M021B08 (ggtc) P136E09 (ggtc) 5SP136E09 (ggtc)
Private Clones OST306573 (lexicon) OST65839 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000677685 (Chr11:62365006..62365097 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000677685 (Chr11:62365006..62365097 +)
Downstram Exon
ENSMUSE00000677684 (Chr11:62365642..62365923 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677685 Chr11:62365006..62365097 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62365098 - 62365641) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000335590 Chr11:62365642..62366714 No primer for this exon
downstream ENSMUSE00000677684 Chr11:62365642..62365923 No primer for this exon
downstream ENSMUSE00000677683 Chr11:62366152..62366708 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTTATAATCGCCTTGCAG Chr11:62365143..62365163 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAGGGGGCTTACGTGACT Chr11:62365136..62365156 60.65 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019505