Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI10980
Trapped Gene
Ccnt2 (ENSMUSG00000026349)
Vector Insertion
Chr 1: 129671760 - 129688181
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) P151F01 (ggtc) (ggtc) E037A02 (ggtc)
(ggtc) P146G03 (ggtc) (ggtc) E031F07 (ggtc) P146G03 (ggtc) E037A02 (ggtc)
(ggtc) IST13878H10 (tigm) IST15003E11 (tigm) IST14929G10 (tigm)
Private Clones OST451995 (lexicon) OST451106 (lexicon) OST437433 (lexicon) OST437425 (lexicon)
OST426213 (lexicon) OST396492 (lexicon) OST374552 (lexicon) OST358204 (lexicon)
OST341535 (lexicon) OST339174 (lexicon) OST325036 (lexicon) OST319322 (lexicon)
OST241868 (lexicon) OST237465 (lexicon) OST188014 (lexicon) OST182816 (lexicon)
OST151579 (lexicon) OST150858 (lexicon) OST149535 (lexicon) OST88688 (lexicon)
OST87682 (lexicon) OST84280 (lexicon) OST65832 (lexicon) OST63771 (lexicon)
OST57890 (lexicon) OST57436 (lexicon) OST43498 (lexicon) OST42660 (lexicon)
OST39646 (lexicon) OST34173 (lexicon) OST32401 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158247 (Chr1:129671678..129671759 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATATGCACCATTCCTTCACCA Chr1:129671725..129671745 60.21 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158247 (Chr1:129671678..129671759 +)
Downstram Exon
ENSMUSE00000158249 (Chr1:129688182..129688310 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATATGCACCATTCCTTCACCA Chr1:129671725..129671745 60.21 42.86 CACTTTTGCAGCCAAAAACA Chr1:129688223..129688242 59.89 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000344861 Chr1:129670741..129670962 GAAGCGGATGAAGAGCTGTC Chr1:129670889..129670908 60.1 55
upstream ENSMUSE00000710550 Chr1:129670741..129670962 GAAGCGGATGAAGAGCTGTC Chr1:129670889..129670908 60.1 55
upstream ENSMUSE00000158247 Chr1:129671678..129671759 ATATGCACCATTCCTTCACCA Chr1:129671725..129671745 60.21 42.86

*** Putative Vector Insertion (Chr 1: 129671760 - 129688181) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158249 Chr1:129688182..129688310 CACTTTTGCAGCCAAAAACA Chr1:129688223..129688242 59.89 40
downstream ENSMUSE00000158245 Chr1:129689935..129689995 No primer for this exon
downstream ENSMUSE00000158243 Chr1:129691832..129691894 TGTGGGTGTTCAATGGTGAT Chr1:129691862..129691881 59.66 45
downstream ENSMUSE00000320862 Chr1:129694418..129694463 GGATGTCTGTGCCAAATCCT Chr1:129694446..129694465 59.93 50
downstream ENSMUSE00000158250 Chr1:129695967..129696130 GTAACCGTGGGGTCCACATA Chr1:129696116..129696135 60.49 55
downstream ENSMUSE00000158242 Chr1:129698183..129698253 TCCAGTTTCGAATCCTCTTCA Chr1:129698253..129698273 59.8 42.86
downstream ENSMUSE00000158248 Chr1:129698739..129699870 TGCACGGCTATCTTGAACAG Chr1:129698942..129698961 60.01 50
downstream ENSMUSE00000692282 Chr1:129698739..129701414 GCACCACATTCCCGTCTAGT Chr1:129700792..129700811 60 55
downstream ENSMUSE00000692276 Chr1:129699969..129702509 GCACCACATTCCCGTCTAGT Chr1:129700792..129700811 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr1:129674810..129674830 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTGTGCTTCTGTCTGCCTA Chr1:129671741..129671761 59.04 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026349