Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI1099
Trapped Gene
Gprasp1 (ENSMUSG00000043384)
Vector Insertion
Chr X: 132286557 - 132330680
Public Clones CE0057 (sanger) 3SD181G05 (ggtc) IST13201B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694483 (ChrX:132286484..132286556 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCTGTGGCTGCATTGTTC ChrX:132286523..132286542 61.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694483 (ChrX:132286484..132286556 +)
Downstram Exon
ENSMUSE00000694476 (ChrX:132330681..132330875 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCTGTGGCTGCATTGTTC ChrX:132286523..132286542 61.08 50 TGGAATGGCAGAGATGTGTC ChrX:132330765..132330784 59.64 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694499 ChrX:132277272..132277517 AGGAGTGGGTACCGAAAGGT ChrX:132277299..132277318 59.86 55
upstream ENSMUSE00000694477 ChrX:132277981..132278061 GTGGGAGAAAGCTGCAAGAC ChrX:132278039..132278058 60 55
upstream ENSMUSE00000719688 ChrX:132278102..132278153 CTCCGCGTTACCCCAACTAT ChrX:132278117..132278136 61.24 55
upstream ENSMUSE00000722218 ChrX:132279038..132279114 AGGAGGAAACAATCCCTTGG ChrX:132279084..132279103 60.3 50
upstream ENSMUSE00000694487 ChrX:132283195..132283321 TCATAGTGCAATCGGACCAA ChrX:132283247..132283266 60.07 45
upstream ENSMUSE00000694483 ChrX:132286484..132286556 ATCCTGTGGCTGCATTGTTC ChrX:132286523..132286542 61.08 50

*** Putative Vector Insertion (Chr X: 132286557 - 132330680) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000454122 ChrX:132330678..132330875 TGGAATGGCAGAGATGTGTC ChrX:132330765..132330784 59.64 50
downstream ENSMUSE00000694476 ChrX:132330681..132330875 TGGAATGGCAGAGATGTGTC ChrX:132330765..132330784 59.64 50
downstream ENSMUSE00000454116 ChrX:132331488..132331576 CAGAAATCCACGCCATTTTC ChrX:132331576..132331595 60.45 45
downstream ENSMUSE00000653663 ChrX:132332092..132332168 TTTGAGACAGTCGCCTTGAA ChrX:132332158..132332177 59.57 45
downstream ENSMUSE00000653662 ChrX:132332327..132332403 TCTGAGACAGTCGCCTTGAA ChrX:132332393..132332412 59.7 50
downstream ENSMUSE00000454092 ChrX:132332562..132332633 TCTGAGACAGTCGCCTTGAA ChrX:132332628..132332647 59.7 50
downstream ENSMUSE00000545909 ChrX:132332930..132333012 TTCTCTGCGTTCAAGTGGTG ChrX:132332986..132333005 60.03 50
downstream ENSMUSE00000497751 ChrX:132333287..132338013 CCAGGACCCAACAGCTATGT ChrX:132336310..132336329 59.99 55
downstream ENSMUSE00000694500 ChrX:132333287..132338005 CCAGGACCCAACAGCTATGT ChrX:132336310..132336329 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC ChrX:132289605..132289625 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGAAAACGTGACTGGGAAA ChrX:132289601..132289621 61.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000043384