Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11030
Trapped Gene
Slain2 (ENSMUSG00000036087)
Vector Insertion
Chr 5: 73357121 - 73365769
Public Clones A044C04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 61% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000230246 (Chr5:73357043..73357120 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGCCAAACAGTTGCTTCC Chr5:73357081..73357100 59.36 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000230246 (Chr5:73357043..73357120 +)
Downstram Exon
ENSMUSE00000652812 (Chr5:73365770..73366085 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGCCAAACAGTTGCTTCC Chr5:73357081..73357100 59.36 45 AGGTGAGGAGGTGGTTTGTG Chr5:73365912..73365931 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696301 Chr5:73305612..73306252 CTTGCTGGACGAGGTAGAGC Chr5:73306175..73306194 60.16 60
upstream ENSMUSE00000652816 Chr5:73305677..73305691 No primer for this exon
upstream ENSMUSE00000544165 Chr5:73305693..73306252 CTTGCTGGACGAGGTAGAGC Chr5:73306175..73306194 60.16 60
upstream ENSMUSE00000544164 Chr5:73332531..73332679 GTTTGGTGCAGGCAAGTTTT Chr5:73332589..73332608 60.15 45
upstream ENSMUSE00000696300 Chr5:73332531..73332679 GTTTGGTGCAGGCAAGTTTT Chr5:73332589..73332608 60.15 45
upstream ENSMUSE00000476964 Chr5:73339801..73339965 ATGCCAGTAGCCCATACAGC Chr5:73339870..73339889 60.12 55
upstream ENSMUSE00000598473 Chr5:73339801..73339965 ATGCCAGTAGCCCATACAGC Chr5:73339870..73339889 60.12 55
upstream ENSMUSE00000486962 Chr5:73346566..73346727 CACTCAGCCCTCAGTCCTCT Chr5:73346599..73346618 59.58 60
upstream ENSMUSE00000598478 Chr5:73346566..73346727 CACTCAGCCCTCAGTCCTCT Chr5:73346599..73346618 59.58 60
upstream ENSMUSE00000652814 Chr5:73348532..73348891 GGAATTCACCACGACCATCT Chr5:73348709..73348728 59.79 50
upstream ENSMUSE00000652813 Chr5:73349388..73349525 TGGAGGAATACCTCGAATGC Chr5:73349488..73349507 60.04 50
upstream ENSMUSE00000230246 Chr5:73357043..73357120 AAAGCCAAACAGTTGCTTCC Chr5:73357081..73357100 59.36 45

*** Putative Vector Insertion (Chr 5: 73357121 - 73365769) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000652812 Chr5:73365770..73366085 AGGTGAGGAGGTGGTTTGTG Chr5:73365912..73365931 60 55
downstream ENSMUSE00000598474 Chr5:73367236..73369619 CAAACAGAAAAACCGGCAAT Chr5:73369370..73369389 59.97 40
downstream ENSMUSE00000706994 Chr5:73367236..73367302 ACAGCCGTCTTTCCAACTGT Chr5:73367299..73367318 59.77 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCCCTCAAAGCCAAACAGT Chr5:73357075..73357095 59.71 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCCCTCAAAGCCAAACAGT Chr5:73357075..73357095 59.71 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036087