Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11033
Trapped Gene
Pgm3 (ENSMUSG00000056131)
Vector Insertion
Chr 9: 86459339 - 86461115
Public Clones W037B08 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219610 (Chr9:86461116..86461183 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCGTGACTGTTTTAGGAG Chr9:86461128..86461147 58.92 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219610 (Chr9:86461116..86461183 -)
Downstram Exon
ENSMUSE00000237343 (Chr9:86459205..86459338 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCGTGACTGTTTTAGGAG Chr9:86461128..86461147 58.92 50 GAATTCCGGCAATACACCAT Chr9:86459262..86459281 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518629 Chr9:86465337..86465434 ACGTCTGCGAGGTCTGAGAG Chr9:86465405..86465424 60.76 60
upstream ENSMUSE00000694631 Chr9:86465337..86465432 ACGTCTGCGAGGTCTGAGAG Chr9:86465405..86465424 60.76 60
upstream ENSMUSE00000437275 Chr9:86463809..86464014 TCATGTTTCGAATGGGATTG Chr9:86463881..86463900 59.33 40
upstream ENSMUSE00000237408 Chr9:86462818..86463002 ACACAGACCGCCTTCGTAGT Chr9:86462836..86462855 59.79 55
upstream ENSMUSE00000219610 Chr9:86461116..86461183 TGGCGTGACTGTTTTAGGAG Chr9:86461128..86461147 58.92 50

*** Putative Vector Insertion (Chr 9: 86459339 - 86461115) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000237343 Chr9:86459205..86459338 GAATTCCGGCAATACACCAT Chr9:86459262..86459281 59.65 45
downstream ENSMUSE00000237315 Chr9:86458284..86458479 CGTTGGCACAGTCAACCTTA Chr9:86458406..86458425 59.76 50
downstream ENSMUSE00000237292 Chr9:86456143..86456300 CAGCATCTCTCACCGGACTT Chr9:86456248..86456267 60.41 55
downstream ENSMUSE00000219613 Chr9:86455428..86455511 CGACTCCGAGGTTCACACTT Chr9:86455462..86455481 60.3 55
downstream ENSMUSE00000219607 Chr9:86453022..86453120 CTTGAGCCTTGTGATGCAAA Chr9:86453044..86453063 59.99 45
downstream ENSMUSE00000479325 Chr9:86452002..86452115 GTCCTGGCTGCTTTTCCTTT Chr9:86452011..86452030 60.74 50
downstream ENSMUSE00000219605 Chr9:86451110..86451232 GCTGTACAGTCAGCCCCTTC Chr9:86451138..86451157 59.87 60
downstream ENSMUSE00000219609 Chr9:86449799..86449972 GTACCAGAGGGCCGTACAAA Chr9:86449817..86449836 59.99 55
downstream ENSMUSE00000694629 Chr9:86448609..86449010 AGCTGGAACACCAGCAAACT Chr9:86448939..86448958 59.91 50
downstream ENSMUSE00000504518 Chr9:86446083..86449010 CATCAGGTGAGGGTGGCTAT Chr9:86447028..86447047 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:86461045..86461065 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAAAGCGTGACTGGGAAAA Chr9:86461050..86461070 61.17 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056131