Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11042
Trapped Gene
Dgcr8 (ENSMUSG00000022718)
Vector Insertion
Chr 16: 18285402 - 18289195
Public Clones (sanger) M059A07 (ggtc) P145C08 (ggtc) D018E11 (ggtc) P107F05 (ggtc)
D106A10 (ggtc) (ggtc) P121C08 (ggtc) P103A04 (ggtc) P145C08 (ggtc)
D018E11 (ggtc) (ggtc) P121C08 (ggtc) P097B09 (ggtc) PST3609-NR (escells)
PST4278-NR (escells) PST15175-NL (escells) PST675-1 (escells) PST11044-NR (escells)
PST4767-NR (escells) PST22086-NR (escells) IST14637D11 (tigm) IST14971H8 (tigm)
IST11585C4 (tigm) IST14351E12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482144 (Chr16:18289196..18289281 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482144 (Chr16:18289196..18289281 -)
Downstram Exon
ENSMUSE00000703653 (Chr16:18285194..18285401 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AGTCAGAGGGCGAGTGAGAC Chr16:18285188..18285207 59.58 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482144 Chr16:18289196..18289281 No primer for this exon
upstream ENSMUSE00000703654 Chr16:18289196..18289342 No primer for this exon

*** Putative Vector Insertion (Chr 16: 18285402 - 18289195) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703653 Chr16:18285194..18285401 AGTCAGAGGGCGAGTGAGAC Chr16:18285188..18285207 59.58 60
downstream ENSMUSE00000392502 Chr16:18283790..18284789 AGGTTCGGACTGTCCATCAC Chr16:18284305..18284324 59.97 55
downstream ENSMUSE00000722294 Chr16:18283790..18284789 AGGTTCGGACTGTCCATCAC Chr16:18284305..18284324 59.97 55
downstream ENSMUSE00000387246 Chr16:18283217..18283376 TGTCTCCGCCATATTTTTCC Chr16:18283264..18283283 59.9 45
downstream ENSMUSE00000483253 Chr16:18280707..18280849 CCCAAGAAGTAGGGTCTGGA Chr16:18280701..18280720 59.13 55
downstream ENSMUSE00000129871 Chr16:18280313..18280595 TGTAGGCAGGGGATACTGCT Chr16:18280536..18280555 59.72 55
downstream ENSMUSE00000129859 Chr16:18278412..18278609 TCTTTGTGGGTGCATCTTGT Chr16:18278393..18278412 59.14 45
downstream ENSMUSE00000129853 Chr16:18278132..18278233 TATAAACAGGGCGGACCTTG Chr16:18278125..18278144 59.95 50
downstream ENSMUSE00000129860 Chr16:18277259..18277357 CCAAAAGGCTCACTTGGATT Chr16:18277314..18277333 59.17 45
downstream ENSMUSE00000129872 Chr16:18272814..18272896 AGTCAGGGATGAGAATTTCCAG Chr16:18272842..18272863 59.58 45.46
downstream ENSMUSE00000129869 Chr16:18259972..18260072 GGCACTCATGGAGGATCTGA Chr16:18259957..18259976 61.2 55
downstream ENSMUSE00000129861 Chr16:18259642..18259748 TCCCAGGAACCACTTCAAAC Chr16:18259677..18259696 59.94 50
downstream ENSMUSE00000129855 Chr16:18258287..18258414 GCTGCTCTCACGACCATACA Chr16:18258280..18258299 60.02 55
downstream ENSMUSE00000129863 Chr16:18256765..18256878 AAGGTTGGGCCTGTTCTTCT Chr16:18256794..18256813 60.11 50
downstream ENSMUSE00000703651 Chr16:18254050..18255698 GAACAGATGGGCTTGGTTGT Chr16:18254838..18254857 59.97 50
downstream ENSMUSE00000390710 Chr16:18254043..18255698 GAACAGATGGGCTTGGTTGT Chr16:18254838..18254857 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTAATCGCCTTGCAGCACA Chr16:18289126..18289146 62.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCCGTGACTGGGAAAAC Chr16:18286129..18286149 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCATAACCACCCCACTCAAC Chr16:18289239..18289259 60.24 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000022718