Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11045
Trapped Gene
Slc25a36 (ENSMUSG00000032449)
Vector Insertion
Chr 9: 96979659 - 96980611
Public Clones W094E04 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000219793 (Chr9:96980612..96980901 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACGGACTGCGAGGATTTTA Chr9:96980824..96980843 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000219793 (Chr9:96980612..96980901 -)
Downstram Exon
ENSMUSE00000332885 (Chr9:96978166..96979658 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACGGACTGCGAGGATTTTA Chr9:96980824..96980843 60.21 50 GCTGCTATCCGTTGAGAAGG Chr9:96979439..96979458 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000530910 Chr9:97011330..97011576 CTCCGACTCCTCACGACTCT Chr9:97011554..97011573 59.58 60
upstream ENSMUSE00000231837 Chr9:97000494..97000658 CCCTGGACCTCTTCATTGTC Chr9:97000498..97000517 59.51 55
upstream ENSMUSE00000583557 Chr9:96997522..96997599 CCTCGCTCGTTGTTTAGAGG Chr9:96997558..96997577 60.01 55
upstream ENSMUSE00000583556 Chr9:96993496..96993596 TGCTGCTTATTCAAACTGCAA Chr9:96993564..96993584 59.64 38.1
upstream ENSMUSE00000219791 Chr9:96985476..96985542 AACAAACCCCATTTGGCTTA Chr9:96985504..96985523 59.31 40
upstream ENSMUSE00000530909 Chr9:96984812..96984846 No primer for this exon
upstream ENSMUSE00000219793 Chr9:96980612..96980901 GACGGACTGCGAGGATTTTA Chr9:96980824..96980843 60.21 50

*** Putative Vector Insertion (Chr 9: 96979659 - 96980611) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000332885 Chr9:96978166..96979658 GCTGCTATCCGTTGAGAAGG Chr9:96979439..96979458 59.98 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCTGCTGCCACCTCAAAAAC Chr9:96980639..96980660 63.95 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCTGCTGCCACCTCAAAAAC Chr9:96980639..96980660 63.95 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032449