Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11046
Trapped Gene
Pten (ENSMUSG00000013663)
Vector Insertion
Chr 19: 32867084 - 32872560
Public Clones E115D01 (ggtc) F15192 (ggtc)
Private Clones OST430661 (lexicon) OST345387 (lexicon) OST283859 (lexicon) OST144018 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000146019 (Chr19:32867039..32867083 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000146019 (Chr19:32867039..32867083 +)
Downstram Exon
ENSMUSE00000146017 (Chr19:32872561..32872604 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000545317 Chr19:32832089..32833013 No primer for this exon
upstream ENSMUSE00000348178 Chr19:32850505..32850589 No primer for this exon
upstream ENSMUSE00000146019 Chr19:32867039..32867083 No primer for this exon

*** Putative Vector Insertion (Chr 19: 32867084 - 32872560) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146017 Chr19:32872561..32872604 No primer for this exon
downstream ENSMUSE00000146011 Chr19:32874351..32874589 No primer for this exon
downstream ENSMUSE00000146009 Chr19:32886186..32886327 No primer for this exon
downstream ENSMUSE00000146006 Chr19:32889907..32890073 No primer for this exon
downstream ENSMUSE00000146015 Chr19:32892326..32892550 No primer for this exon
downstream ENSMUSE00000620052 Chr19:32894333..32894554 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAAGTTTAATCGCCTTGCAG Chr19:32867128..32867149 58.58 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTTCGTGACTGGGAAAACC Chr19:32867130..32867151 60.39 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013663