Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11071
Trapped Gene
Yars2 (ENSMUSG00000022792)
Vector Insertion
Chr 16: 16304797 - 16306555
Public Clones E126E05 (ggtc) E126E05 (ggtc) G063D02 (ggtc) IST12981D12 (tigm) IST14591G11 (tigm)
IST14640D7 (tigm) IST14935H3 (tigm) IST13435C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000520296 (Chr16:16304629..16304796 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGTTTGGCTAAACAGAGA Chr16:16304714..16304733 60.39 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000520296 (Chr16:16304629..16304796 +)
Downstram Exon
ENSMUSE00000509987 (Chr16:16306556..16306711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGTTTGGCTAAACAGAGA Chr16:16304714..16304733 60.39 50 GCAACTCGCTTTTCTGGTTC Chr16:16306645..16306664 60 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000514361 Chr16:16303075..16303840 TGGCGGAGTTCTTTTACCAG Chr16:16303708..16303727 60.24 50
upstream ENSMUSE00000520296 Chr16:16304629..16304796 GCGGTTTGGCTAAACAGAGA Chr16:16304714..16304733 60.39 50

*** Putative Vector Insertion (Chr 16: 16304797 - 16306555) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000509987 Chr16:16306556..16306711 GCAACTCGCTTTTCTGGTTC Chr16:16306645..16306664 60 50
downstream ENSMUSE00000130456 Chr16:16307303..16307473 GACCTCCAGTGCCTCTATGC Chr16:16307351..16307370 59.83 60
downstream ENSMUSE00000335313 Chr16:16309425..16309720 TACATTGTGAGGGGCCTTGT Chr16:16309682..16309701 60.38 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATTCAGTAATCGCCTTGC Chr16:16304840..16304860 58.87 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTCAGCGTGACTGGGAAA Chr16:16304841..16304861 61.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022792