Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI11091
Trapped Gene
Mthfd1l (ENSMUSG00000040675)
Vector Insertion
Chr 10: 6262805 - 6289679
Public Clones (sanger) (sanger) (sanger) G056A07 (ggtc) G005C06 (ggtc) G054F10 (ggtc)
E122A07 (ggtc) G056E06 (ggtc) G069H06 (ggtc) (cmhd) IST14686B1 (tigm)
IST14686B1 (tigm)
Private Clones OST432910 (lexicon) OST197624 (lexicon) OST173277 (lexicon)
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000326288 (Chr10:6289680..6289791 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000326288 (Chr10:6289680..6289791 -)
Downstram Exon
ENSMUSE00000441341 (Chr10:6262665..6262804 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000326438 Chr10:6373063..6373397 No primer for this exon
upstream ENSMUSE00000666815 Chr10:6373063..6373428 No primer for this exon
upstream ENSMUSE00000708310 Chr10:6373063..6373423 No primer for this exon
upstream ENSMUSE00000710810 Chr10:6373063..6373410 No primer for this exon
upstream ENSMUSE00000326431 Chr10:6367823..6367907 TCCAAGGAAGTGCTGAGCTT Chr10:6367872..6367891 60.13 50
upstream ENSMUSE00000326423 Chr10:6366275..6366325 CCGGTGATGACAATTTGATG Chr10:6366305..6366324 59.77 45
upstream ENSMUSE00000326415 Chr10:6366137..6366190 GCTGGTCTGGACATCACTCA Chr10:6366171..6366190 59.83 55
upstream ENSMUSE00000326406 Chr10:6362333..6362457 ATGAAGACCCCAGAGTGCAT Chr10:6362413..6362432 59.53 50
upstream ENSMUSE00000326402 Chr10:6360875..6360975 TCAATCTGGGGAAGCTCGTA Chr10:6360945..6360964 60.73 50
upstream ENSMUSE00000326395 Chr10:6356544..6356680 No primer for this exon
upstream ENSMUSE00000441421 Chr10:6338688..6338799 CCATCAGGAACCACCATTCT Chr10:6338714..6338733 59.78 50
upstream ENSMUSE00000441414 Chr10:6330936..6331027 GAGAGCGTGAGTCTCCTTGC Chr10:6330955..6330974 60.29 60
upstream ENSMUSE00000441408 Chr10:6329720..6329817 CAGAGAGCAGCAACATCGAA Chr10:6329769..6329788 60.29 50
upstream ENSMUSE00000441403 Chr10:6327942..6328115 AAGTCCAATTGTCCCTGCTG Chr10:6327989..6328008 60.11 50
upstream ENSMUSE00000441397 Chr10:6318010..6318146 GGACCCACTTTTGGAGTGAA Chr10:6318012..6318031 59.94 50
upstream ENSMUSE00000441389 Chr10:6315805..6315851 CTGCAGGAGGTGGATATGCT Chr10:6315826..6315845 60.24 55
upstream ENSMUSE00000441383 Chr10:6314202..6314309 AGCCATCGACACGAGAATTT Chr10:6314228..6314247 59.7 45
upstream ENSMUSE00000441377 Chr10:6313178..6313252 No primer for this exon
upstream ENSMUSE00000441374 Chr10:6311223..6311325 ACTGACCGAGGAGGAAGTGA Chr10:6311274..6311293 59.83 55
upstream ENSMUSE00000441370 Chr10:6304692..6304768 GACACGAACGACCGATTTCT Chr10:6304744..6304763 60.12 50
upstream ENSMUSE00000326344 Chr10:6298570..6298710 ACATGAAAGAGCGGCTAGGA Chr10:6298624..6298643 59.98 50
upstream ENSMUSE00000326333 Chr10:6298273..6298341 TTTGATGAAAGACGCCATCA Chr10:6298299..6298318 60.2 40
upstream ENSMUSE00000326288 Chr10:6289680..6289791 No primer for this exon

*** Putative Vector Insertion (Chr 10: 6262805 - 6289679) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000441341 Chr10:6262665..6262804 No primer for this exon
downstream ENSMUSE00000441327 Chr10:6258266..6258307 GAGAGGAACCCCAGCAGTTA Chr10:6258265..6258284 59.28 55
downstream ENSMUSE00000441325 Chr10:6257146..6257246 GCTGAGCGATCTGAATTTGC Chr10:6257164..6257183 61.03 50
downstream ENSMUSE00000441320 Chr10:6256368..6256545 TTTAGCGAGCTCACACACCA Chr10:6256478..6256497 60.6 50
downstream ENSMUSE00000441313 Chr10:6243198..6243305 CTCAATGTCCTTGGCTCCAT Chr10:6243221..6243240 60.07 50
downstream ENSMUSE00000441308 Chr10:6240012..6240164 CGTTCCCACCAAAGGATAAA Chr10:6239990..6240009 59.79 45
downstream ENSMUSE00000441470 Chr10:6198415..6198532 TGCTCCGTTTCTGTGTCAAG Chr10:6198440..6198459 60.03 50
downstream ENSMUSE00000705489 Chr10:6190438..6190891 AAACTCCAAAGACGGAAGCA Chr10:6190553..6190572 59.85 45
downstream ENSMUSE00000577400 Chr10:6190430..6190999 AACACCACTTGGCTGGAAAC Chr10:6190715..6190734 60.01 50
downstream ENSMUSE00000711680 Chr10:6179460..6180060 GTGCTTTTCGCTACGAGACC Chr10:6179874..6179893 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:6283609..6283629 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTCAATTCCCAGCACTCG Chr10:6283632..6283652 60.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGCTGCTAGAGTGCGGTGTAA Chr10:6283738..6283759 60.22 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGTTGTTTTAGGAAACTTGGTA Chr10:6283805..6283828 58.54 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040675